Labshake search
Citations for Qiagen :
2201 - 2250 of 3142 citations for 1 2 2 morpholin 4 ium 4 ylethoxy phenyl butan 1 one chloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2024Quote: ... was used to transfect HMEC-1 with siRNA control or siRNA MC1R oligonucleotides (Qiagen) (20 nM final concentration).
-
bioRxiv - Molecular Biology 2024Quote: Total RNA was isolated from 1 × 106 cells using RNeasy Plus Mini Kit (Qiagen) with genomic DNA removal ...
-
bioRxiv - Cancer Biology 2024Quote: ... Total RNA (1 μg) was reverse transcribed using the Quantitect Reverse Transcription Kit (Qiagen). Subsequently ...
-
bioRxiv - Cell Biology 2024Quote: ... Reverse transcription of 1 μg RNA was performed using Omniscript RT kit (Qiagen, #205111). CLN3 transcript was amplified ...
-
bioRxiv - Immunology 2024Quote: ... ∼1000 macrophages were sorted into 75µL of RLT buffer (Qiagen, containing 1% beta-mercaptoethanol), vortexed for 1 min and immediately frozen (−80°C) ...
-
bioRxiv - Evolutionary Biology 2021Quote: Total retinal mRNA was extracted from one of each study animal’s retinas with an RNeasy Mini Kit and QIAshredder (Qiagen, Valencia, CA, USA), quantified with a NanoVue spectrophotometer (GE Healthcare ...
-
bioRxiv - Molecular Biology 2021Quote: ... We collected 20 CA1 dissectates in one isolation cap (Molecular Machines and Industries GmbH, Eching, Germany) before adding RLT lysis buffer (AllPrep Kit, Qiagen, Hilden, Germany). Samples from one individual were collected the same day ...
-
bioRxiv - Biophysics 2021Quote: ... with a double digoxigenin-labeled primer (Biomers GmbH) on one side and a phosphoprimer on the other side and purified using the QIAquick PCR purification kit (Qiagen, Hilden, Germany). The phosphorylated strand is digested by Lambda exonuclease (New England Biolabs ...
-
bioRxiv - Genetics 2021Quote: ... Genomic DNA was isolated from seedlings in the one to three leaf stage using Qiagen BioSprint 96 Plant kits and the Qiagen BioSprint 96 workstation (Qiagen, Germantown, MD). DNA libraries were prepared following the protocol of DNA digestion with PstI and MspI restriction enzymes (Poland et al ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA was extracted from a cell pellet with approximately one million ECs or VSMCs at the third passage using an RNeasy Mini Kit (Qiagen, Venlo, Netherlands). The remaining genomic DNA traces were removed with an on-column DNase digestion (Qiagen ...
-
bioRxiv - Genetics 2021Quote: ... Genomic DNA was isolated from individual seedlings at the one-to three-leaf stage using Qiagen BioSprint 96 Plant kits and the Qiagen BioSprint 96 workstation (Qiagen, MD, USA). Genotyping by sequencing was conducted using Illumina HiSeq® 2500 and NovaSeq 6000 ...
-
bioRxiv - Zoology 2021Quote: ... High-molecular-weight genomic DNA was prepared from the kidney of one male shrew using a Genomic-tip 20/G (QIAGEN, Germantown, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... Correct introduction of the NS1 mutations was verified via cDNA synthesis of viral RNA using the One-Step RT-PCR kit (Qiagen, Hilden, Germany), amplification and sequencing using NS-specific primers ...
-
bioRxiv - Evolutionary Biology 2020Quote: We extracted DNA from 21 modern cheetah and one Puma concolor tissue sample using the Quiagen DNeasy Blood and Tissue kit (Qiagen, Venlo, Netherlands) and 32 diluted blood samples using the innuPREP Blood Kit (Analytik Jena AG ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA was extracted from pooled ipsilateral lumbar (L4-6) DRGs from one rat using the Qiagen RNeasy Mini Prep Kit (Qiagen, Valencia, CA) with on-column DNase digestion (Qiagen ...
-
bioRxiv - Physiology 2021Quote: ... reaction tubes were transferred to a Rotor-Gene Q PCR thermal cycler for product amplification using a one-step protocol (QuantiFast SYBR® Green RT-PCR Kit, Qiagen, UK). The amplification protocol was as follows ...
-
bioRxiv - Genetics 2021Quote: ... Genomic DNA was isolated from seedlings at the one to three leaf stage using Qiagen BioSprint 96 Plant kits and the Qiagen BioSprint 96 workstation (Qiagen, Germantown, MD). DNA libraries were prepared following the protocol of DNA digestion with PstI and MspI restriction enzymes (Poland et al ...
-
bioRxiv - Genomics 2020Quote: ... we extracted genomic DNA from leaf segments cut from areas with one pustule or very few pustules using the DNeasy Plant Mini Kit (Qiagen, Valencia, CA). We then amplified the ITS2 region using the primer pair RUST2inv (5′-GATGAAGAACACAGTGAAA ...
-
bioRxiv - Molecular Biology 2024Quote: ... Total DNA was isolated from the dried feces (one fecal sample was ca. 60 mg) using a DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and purified using a Geneclean Spin Kit (MP-Biomedicals ...
-
bioRxiv - Immunology 2022Quote: ... The AhR mRNA was quantified by one step SYBR Green real-time RT-PCR using the AhR Quantitect primer (Qiagen, Hilden, Germany). The RT-PCR reactions were carried out using the Light Cycler 480 II (Roche ...
-
bioRxiv - Microbiology 2023Quote: ... before longitudinally dividing the abdomen in half and extracting DNA from one half using DNeasy Blood and Tissue extraction kits (Qiagen, Germantown, MD) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... the aqueous phase was mixed with one volume of 70% ethanol and passed through an RNeasy spin column (QIAGEN RNeasy Mini Kit). RNA quality was determined using the High Sensitivity RNA ScreenTape Assay (Agilent 5067-5579) ...
-
bioRxiv - Immunology 2023Quote: ... Spleens were harvested at indicated timepoints and homogenized in a 2ml homogenizer tube (Fisher Brand Cat. 14-666-315) containing 1ml sterile PBS and one 5mm stainless steel bead (QIAGEN Cat. 69989). For oral infection ...
-
bioRxiv - Neuroscience 2024Quote: ... snap-frozen tissue was processed by adding 500 µl of QIAzol reagent in the presence of one 5-mm stainless steel bead (Qiagen, Hilden, Germany). Total RNA isolation from homogenized tissues was performed using a Qiagen RNeasy kit (Qiagen ...
-
bioRxiv - Neuroscience 2019Quote: Total RNA was extracted from ten pooled larval fish or one dissected adult brain per sample (RNeasy mini Kit; Qiagen, Valencia, CA, USA) for quantitative RT-PCR (qRT-PCR) ...
-
bioRxiv - Plant Biology 2020Quote: Leaf tissue from one of the sampled individuals per accession was used for DNA extraction using the Qiagen DNeasy kit (Qiagen, Valencia, CA, USA). Integrity of DNA was verified as a single high molecular weight band on a 1% agarose gel ...
-
bioRxiv - Microbiology 2022Quote: ... we added 500 μL of TRIzol and one 3-mm glass bead to the microtubes with mosquitoes and then homogenized the samples in a TissueLyser® (QIAGEN, Hilden, Germany) at 30 Hz for 3 min ...
-
bioRxiv - Microbiology 2022Quote: ... Total extracted RNA was resuspended in nuclease free water and one microgram was used for cDNA synthesis using the Quantitect reverse transcription kit (Qiagen, Germantown, MD, USA) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Then midguts were transferred on ice into a 2 ml microtube containing 200 µL of PBS1x with anti-proteases and crushed one minute at 30Hz with a Tissue Lyser (Qiagen, Tissue Lyser LT).
-
bioRxiv - Genomics 2019Quote: ... Total genomic DNA was extracted between one and five times using either the Qiagen DNeasy Blood and Tissue Kit (Qiagen, Cat. No. 69504) or the QuickGene DNA Whole Blood or Tissue Kit (Kurabo Industries) ...
-
bioRxiv - Cancer Biology 2019Quote: Total genomic DNA was extracted from 14 BRCA+ tumor samples from 13 patients (DNA was extracted from both breasts for one patient) using AllPrep DNA/RNA Mini Kit (Qiagen, Cat. No 80204). The matched control DNA was also isolated from blood of the same patients using Gentra Puregene Blood Kit (Qiagen ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... DNA was extracted in a pooled reaction (up to 10 wasps from one brood per reaction) using the Qiagen DNAeasy blood & tissue kit (QIAGEN Inc, Hilden, Germany). After extraction DNA was amplified in a multiplex PCR reaction using fluorescently labelled Lysi07 primers ...
-
bioRxiv - Cell Biology 2023Quote: RNA was extracted from the hearts of either one-week old or three-week old female flies using the miRNeasy Mini Kit (QIAGEN, Germantown, MD, USA) as per manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Total genomic DNA was extracted between one and five times per sample using the DNeasy Blood and Tissue Kit (Qiagen, Cat. No. 69504). Elutions were pooled and concentrated in an Eppendorf Concentrator Plus at 45°C and 1400 rpm until roughly 50 µl remained ...
-
bioRxiv - Immunology 2023Quote: Whole livers were harvested at indicated timepoints and placed into a 7 ml homogenizer tube (Omni International Cat. No. 19-651) containing 3 mL sterile PBS and one 5 mm stainless steel bead (QIAGEN Cat. No. 69989). Spleens and single granulomas were harvested at indicated timepoints and placed into a 1 ml homogenizer tube (Fisher Brand Cat ...
-
bioRxiv - Microbiology 2023Quote: ... Primers and probe targeting the AIV matrix gene 36 were used to perform the quantitative RT-PCR (qRT-PCR) reaction by using the One-Step RT-PCR Kit (QIAGEN, Valencia, CA, USA) on a StepOne Real-time PCR System (Applied Biosystems ...
-
bioRxiv - Microbiology 2020Quote: ... Total DNA was extracted from 1 ml liquid samples using DNeasy Blood & Tissue kit (Qiagen). The variable ends of subtype II-C and type VI-B loci (C1 and C2 ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Microbiology 2021Quote: ... The qPCR reaction mixture (10 μL) comprised 1× Rotor-Gene SYBR green PCR mix (Qiagen), 500 nM of each primer ...
-
bioRxiv - Genomics 2020Quote: RNA was purified from approximately 1 × 107 CHM13 cells using an RNeasy kit (Qiagen; 74104) and prepared into Iso-Seq libraries following a standard protocol68 ...
-
bioRxiv - Genomics 2020Quote: ... S2 cells were transfected with 1 ug plasmid DNA using the Effectene reagent kit (Qiagen). The plasmid DNA which contains cDNA of FLAG-tagged ECDs are under the metallothionein promoter control ...
-
bioRxiv - Molecular Biology 2021Quote: ... Unbound Biotin-HPDP was removed by chloroform/isoamylalcohol (24:1) extraction in MaXtract tubes (Qiagen). RNA was precipitated with 10th volume of 5M NaCl and 1 volume of isopropanol ...
-
bioRxiv - Molecular Biology 2021Quote: ... The backbone was extracted from a 1% agarose gel using QIAquick Gel Extraction Kit (Qiagen) and the minigene insert was cleaned up using QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Biophysics 2019Quote: ... proteins were purified by batch Ni-NTA bead purification (1 mL slurry/1L culture; Qiagen) and further purified by a Superdex 200 16/60 column (GE Healthcare ...
-
bioRxiv - Cancer Biology 2019Quote: ... following the manufacturer’s instructions and treated twice with DNase I (1 unit/µg RNA, Qiagen). The RNA concentration was quantified using nanodrop2000 (Thermo Fisher ...
-
bioRxiv - Plant Biology 2019Quote: ... with 1 min shaking at 25 Hz in the Tissue Lyser II (Qiagen, Hilden, Germany). Ground tissue was stored at −80 °C ...
-
bioRxiv - Genetics 2019Quote: ... DNA from FFPE sample 6005-1 was extracted using QIAamp DNA FFPE Tissue Kit (Qiagen). Genomic DNA and RNA were extracted from peripheral blood leukocytes from patient 6003 and from a non-HHT control individual using the Gentra PureGene Blood Kit (Qiagen ...
-
bioRxiv - Genomics 2020Quote: ... The supernatant of cell lysate was incubated with 1 mL Ni-NTA agarose beads (QIAGEN) at 4 °C for 1 h ...
-
bioRxiv - Immunology 2019Quote: ... Purified RNA (1 μg) was reverse-transcribed to cDNA using RT2 First Strand Kit (Qiagen, Hilden ...
-
bioRxiv - Cell Biology 2019Quote: ... Co-NTA beads were obtained from stripping 1 mL of Ni-NTA resin from Qiagen in a Bio-rad gravity column with 50 mL of 0.5M EDTA (pH 8.0) ...