Labshake search
Citations for Qiagen :
2051 - 2100 of 10000+ citations for Mouse T Cell Surface Glycoprotein CD8 Beta Chain CD8B ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... Cells were lysed after 24 hours and RNA was extracted using RNeasy Mini kit (Qiagen) according to manufacturer’s protocol ...
-
Empowering Engineered Muscle Function by Extending Connexin 43 Duration with Reduced Graphene OxidesbioRxiv - Bioengineering 2021Quote: ... Total RNA from the samples was extracted from cells using the RNeasy Mini Kit (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were harvested and DNA purified using the Blood and Tissue DNA kit (Qiagen, MD). A 241 base pair amplicon spanning the AAVS1 target site was amplified in 25 cycles using NEB One Taq (AAVS1 −80bp Forward 5’ GACCACCTTATATTCCCAGG ...
-
bioRxiv - Cell Biology 2021Quote: ... Total RNA was extracted from human tissue and cells using the miRNeasy Mini kit (Qiagen) or TRIzol reagent (ThermoFisher Scientific).
-
bioRxiv - Developmental Biology 2021Quote: Genomic DNA from cells or teratomas was isolated using the DNeasy Blood & Tissue kit (Qiagen) as per manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: The genomic DNA was prepared from the ear punching with Gentra Puregene Cell Kit (Qiagen), or from embryos at various developmental stages with Gentra Puregene Cell Kit or AllPrep DNA/RNA FFPE Kit (Qiagen) ...
-
bioRxiv - Developmental Biology 2021Quote: Total RNA was extracted from cells and tissues using the RNeasy Plus Mini Kit (Qiagen). cDNA was synthesized using Superscript II Reverse Transcriptase (Invitrogen) ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA was extracted from cells at 24h post-withdrawal using the RNeasy micro kit (Qiagen). cDNA libraries were constructed using the Takara SmartSeq for Ultra Low Input kit and sequenced using a HiSeq 2500 Sequencer (Illumina ...
-
bioRxiv - Genetics 2021Quote: Total RNA was isolated and purified from cultured cells with the RNeasy Mini kit (Qiagen). 1.5 µg of total RNA was reverse-transcribed to cDNA in a 20 µl mixture of random primers ...
-
bioRxiv - Genetics 2021Quote: Total RNA was extracted from sorted cells using the miRNeasy Serum/Plasma Kit (QIAGEN; 217184). Concentration and quality were assessed using the Agilent BioAnalyzer RNA 6000 Pico Kit (Agilent ...
-
bioRxiv - Genetics 2020Quote: ... Cells were transfected with 1.5ug of each plasmid DNA with the Effectene transfection kit (Qiagen). After 48 hours in transfection complex ...
-
bioRxiv - Genetics 2020Quote: Total RNA was isolated from the transfected HeLa cells using the RNeasy mini kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: Total RNA was isolated from cultured cells and tissues using the RNeasy Mini Kit (Qiagen) with on-column DNAse treatment ...
-
bioRxiv - Microbiology 2021Quote: ... DNA from the resulting cell pellet was extracted using the Gentra Puregene Tissue Kit (QIAGEN) according to manufacturer’s protocol and diluted to ∼10 nanograms/microliter each ...
-
bioRxiv - Evolutionary Biology 2020Quote: Genomic DNA was amplified using a REPLI-g Single Cell Kit (Qiagen, Germantown, MD, USA) using UV-treated sterile plasticware and reverse transcription-PCR grade water (Ambion ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was extracted from cells using the QIAmp DNA Mini Kit (Qiagen ref. 51306) or ...
-
bioRxiv - Immunology 2021Quote: ... RNA was isolated from frozen peripheral blood mononuclear cells using the RNAEasy Mini kit (Qiagen) per manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: Total RNA was extracted from cells using the Qiagen RNeasy RNA extraction kit (Qiagen, Netherlands), using on-column DNAseI treatment ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was isolated from different cells using the miRNeasy Mini Kit (217004, QIAGEN, Germany) according to the manufacturer’s instructions and quantified using the DS-11 Sepectrophotometer (DeNovix ...
-
bioRxiv - Developmental Biology 2021Quote: ... Total RNA was isolated from C2C12 cells using a RNeasy Plus Universal kit (Qiagen #73404) and cDNA was synthesized using an iScript cDNA synthesis kit (BioRad #170-8890) ...
-
bioRxiv - Immunology 2021Quote: ... cells were washed in 1X PBS and then RNA was extracted using RNeasy kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... after which cell pellets were collected and RNA extracted with the RNeasy mini kit (Qiagen). 30 ng of RNA was used as input for the analysis using the nCounter SPRINT Profiler (NanoString Technologies ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA was prepared from MCF10AmCh and MCF10AF1F2 cells using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... Total RNA was isolated from cell lines using the RNeasy Plus Mini Kit (Qiagen, 74134). The following primers are located within the 3x FLAG tag sequence and were used to quantify ectopic FLAG-RNF168 expression ...
-
bioRxiv - Molecular Biology 2020Quote: ... DNA was isolated from rat blood cells using QIAmp DNA Mini Kit (Qiagen, City, state) following manufacturer’s instructions using a QIAcube automated device ...
-
bioRxiv - Immunology 2022Quote: Total RNA was isolated from sorted cells using either the RNeasy Micro Kit (#74004, Qiagen) or the QuickRNA Microprep Kit (#R1051 ...
-
bioRxiv - Immunology 2022Quote: Total RNAs were extracted from 1,000-5,000 cells using an RNeasy Plus Micro Kit (QIAGEN) and cDNAs were synthesized using a SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Clontech ...
-
bioRxiv - Neuroscience 2022Quote: Total RNA was isolated from ATXN3shRNA and SCRshRNA cells using an miRNeasy mini kit (Qiagen) and quality assessment was achieved using RNA 6000 Nano labchip (Bioanalyzer ...
-
bioRxiv - Biophysics 2022Quote: ... coli DH5α cells and isolated through the QIAprep Spin Miniprep Kit (Qiagen; Cat. No. 27106). All the cloned plasmids (Supplementary Table S3 ...
-
bioRxiv - Cancer Biology 2022Quote: ... PAR1-KO and PAR2-KO PC3 cells were extracted using a RNeasy Mini Kit (Qiagen). RNA quality ...
-
bioRxiv - Cell Biology 2022Quote: Cells were lysed and total RNA was isolated using RNeasy micro kit (Qiagen Cat. 74004) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: RNA from one million cells was isolated using the RNeasy plus mini kit (Qiagen #74134). 5μg of RNA was subjected to ribosomal and mitochondrial RNA depletion using the RiboZero Gold kit (Human/Mouse/Rat ...
-
bioRxiv - Cell Biology 2022Quote: ... Total RNA was extracted from these cells using a RNeasy Mini kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA was extracted from cells in 6 cm dishes using the RNeasy kit (Qiagen # 74106) according to manufacturer instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... Genomic DNA was prepared using the Blood and Cell Culture DNA Maxi Kit (Qiagen 13362). To determine sgRNA distribution in the initial and final cell populations ...
-
bioRxiv - Cancer Biology 2022Quote: ... and total RNA from sorted cells was isolated using the RNeasy Micro Kit (Qiagen, USA); frozen human samples were disrupted in 600 µl of lysis buffer containing green ceramic beads using the MagNA Lyser Instrument (Roche Life Science ...
-
bioRxiv - Immunology 2022Quote: Sorted B cells were lysed for RNA extraction by the RNeasy Micro Kit (Qiagen, 74004). Primers used for reverse transcription and library amplification are provided in Table S2 ...
-
bioRxiv - Evolutionary Biology 2022Quote: Total DNA isolation from cell pellets was performed using DNeasy Blood & Tissue Kit (QIAGEN, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... genomic DNA from buccal swabs was extracted with Gentra Buccal Cell Kit (QIAGEN, cat.no: 158845) and stored at -20°C ...
-
bioRxiv - Microbiology 2022Quote: Total RNA was extracted from 5 million cells using RNeasy Plus Universal Kits (Qiagen, #73404) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... FVVs RNAs were extracted from raw cell supernatants with QIAamp Viral RNA Extraction Kit (Qiagen). RNAs were treated with DNA free kit (Life Technologies) ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA samples were extracted from 1 million cells using the RNeasy Mini Kit (Qiagen, 74136) and treated with TURBO DNA-freeTM Kit (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... Cell pellets were used for mRNA extraction using the RNeasy Plus Mini kit (Qiagen, 74136) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Total DNA from HeLa infected cells were extracted with the QiAmp DNA Mini kit (Qiagen). Differential DNA denaturation polymerase chain reaction (3D-PCR ...
-
bioRxiv - Physiology 2023Quote: RNA was extracted from human primary cells using AllPrep RNA/RNA/miRNA universal kit (Qiagen) according to manufacturer instructions ...
-
bioRxiv - Immunology 2022Quote: ... Genomic DNA from sorted cells was prepared using a DNeasy Blood and Tissue Kit (Qiagen) according to the manufacturer’s protocol.
-
bioRxiv - Developmental Biology 2022Quote: Total RNA was extracted from tissues or cells using RNeasy Plus Mini Kits (Qiagen – 74134). Small RNAs were extracted using mirVana kits (ThermoFisher Scientific - AM1560 ...
-
bioRxiv - Cell Biology 2022Quote: ... gDNA was isolated from cells via DNeasy Blood and Tissue Kit (Qiagen, Cat. No. 69504) and processed as described in Buenrostro et al ...
-
bioRxiv - Microbiology 2022Quote: ... The cells were harvested and total RNA was extracted using RNeasy Mini Kit (Qiagen, 74106). Thereafter ...
-
bioRxiv - Genetics 2023Quote: Total RNA was isolated from colon samples or cell suspensions using RNeasy Mini Kit (Qiagen), and quantitative RT-PCR performed using SuperScript II Reverse Transcriptase (Life Technologies ...