Labshake search
Citations for Qiagen :
2001 - 2050 of 2779 citations for 4 2 Hydroxy 1 Methoxyethyl 1 2 Benzenediol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... The tissue pellets were resuspended in 1 ml of FSW using a tissue lyser (Tissue-Lyser II, Qiagen, Australia) and the resuspension was homogenized using sterile glass homogenizers for 30 s ...
-
bioRxiv - Cancer Biology 2022Quote: ... DNA was lysed with a lysis buffer (10 mM Tris-HCl, pH 8.0, 150 mM NaCl, 20 mM EDTA, 1% SDS) and proteinase K (Qiagen) was added to samples to degrade proteins ...
-
bioRxiv - Immunology 2022Quote: ... The complementary DNA (cDNA) was synthesized from 1 μg of total RNA using QuantiTect Reverse Transcription Kit (Qiagen: 205311) and quantitative PCR (qPCR ...
-
bioRxiv - Microbiology 2022Quote: ... 1 μg of extracted RNA from each sample was used for the cDNA synthesis (cDNA synthesis kit, Qiagen, Germany) according to the suppliers’ protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA-seq libraries were prepared from 1 μg total RNA using the QIAseq FastSelect -rRNA Yeast kit (Qiagen 334217) and QIAseq Stranded RNA Library kit (Qiagen 180743 ...
-
bioRxiv - Biophysics 2023Quote: ... The supernatant was diluted 3 times with buffer A (20 mM HEPES, pH 7.4, 200 mM NaCl, 1 mM Asp) and incubated with Ni-NTA resin (Qiagen) for 1 hour at 4 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... culture medium was replaced with base medium 1 hour before transfection and cells were transfected with miRNA mimics (Qiagen), including hsa-let-7a-5p (UGAGGUAGUAGGUUGUAUAGUU) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The OsHV-1 µVar DNA was extracted from 200 µL of water using the QIAmp DNA mini Kit (QIAGEN). Quantitative PCR was performed with 5 µL of DNA as described 46.
-
bioRxiv - Physiology 2024Quote: ... RNA (1 μg, quantified via Nanodrop-2000 spectrophotometer) was transcribed to cDNA using the QuantiTect Reverse Transcription kit (QIAGEN) and stored at -20°C prior to analysis ...
-
bioRxiv - Plant Biology 2024Quote: ... four leaf discs (1 cm in diameter) were snap frozen in liquid nitrogen and powdered using a TissueLyser (QIAGEN). Total proteins were extracted from the powder using 400 μL GTEN buffer (10% glycerol ...
-
bioRxiv - Plant Biology 2024Quote: ... and ground for 1 min at 30 Hz with the pre-cooled Retsch Mill (Tissue Lyser II, Retsch, Qiagen). For quantification of S ...
-
bioRxiv - Microbiology 2024Quote: ... cDNA was synthesized from 1 µg of total RNA using the RT2 First Strand Kit (Qiagen, Germantown, MD, USA), following the manufacturer’s guidelines ...
-
bioRxiv - Cell Biology 2024Quote: ... and were then incubated with or without triton-x (1% v/v) and with or without Rnase-A (Qiagen #19101 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 × 106 MES or CP cells were harvested and RNA extraction was performed using Rneasy mini plus kit (Qiagen). 1 μg of total RNA was used for the construction of sequencing libraries and sequencing.
-
bioRxiv - Microbiology 2024Quote: ... for 10 min and the cell lysates were incubated with 1 mL of prewashed Ni-NTA Agarose beads (QIAGEN) shaking at 4°C for 1.5 h ...
-
bioRxiv - Microbiology 2024Quote: The typhoid toxin was purified from BL21 DE3 pETDuet-1 encoding pltBHis pltAMyc and cdtBFLAG using NiNTA agarose (Qiagen) affinity chromatography according to manufacturer instructions as previously described (Ibler et al 2019) ...
-
bioRxiv - Microbiology 2024Quote: ... DNA on the exterior of filtered capsids was digested for 1 h at 25°C with 20.3 units DNase (79254; Qiagen) supplemented with 10 mM MgCl2 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Complementary DNA (cDNA) was synthesized from 1 ug of RNA using the QuantiTect reverse transcription kit (Qiagen, catalog #205311) following the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 1 mL of TRIzol reagent was added to each sample and homogenized using a TissueLyser LT (Qiagen, Hilden, Germany) for 2 minutes at 50 Hz ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 μg of total RNA was used to synthesize cDNA using a QuantiNova Reverse Transcription kit (205410, Qiagen, UK). qPCR was performed using QuantiNova SYBR green (208052 ...
-
bioRxiv - Microbiology 2024Quote: ... Samples were then incubated with Dynabeads for 2hr at 4°C and washed as previously described [89] prior to being eluted in elution buffer (1% SDS, 1mM EDTA, 0.01M pH 8 Tris-HCl, and 0.2M NaCl) supplemented with proteinase K (Qiagen, 1114885) and Rnase A (Invitrogen ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 1 mL of TRIzol reagent was added to each sample and homogenized using a TissueLyser LT (Qiagen, Hilden, Germany) for 2 minutes at 50 Hz ...
-
bioRxiv - Genomics 2024Quote: Total RNA was isolated from 1 million microglial cells per cell line using the RNeasy Mini kit (QIAGEN, #74104) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... using random hexamers and diluted 1:10 prior to quantification by qPCR (QuantiFast SYBR Green PCR kit, Qiagen, #28025013) using a Corbett Rotor-Gene 6000 (Qiagen ...
-
bioRxiv - Synthetic Biology 2024Quote: ... samples were subjected to bead-beating by adding 100 mg of 0.1 mm zirconia beads and 1 ml of inhibiTEX buffer (Qiagen) to each tube ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were incubated with 20 μg/ml propidium iodide (containing 0,5% Tween-20, 1% BSA and 10 μg/ml RNase A (Qiagen) for 30 min at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 µg of viral RNA were utilized to transfect HeLa cells cultured at 37°C using TransMessenger reagent (Qiagen) following the manufacturers protocol ...
-
bioRxiv - Genetics 2024Quote: ... Red blood cells were lysed with 0.1% saponin in 1×PBS and parasite DNA extracted with the QIAamp DNA Blood Midi Kit (Qiagen) using a combined RNase and Proteinase K treatment ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was isolated from 4 mL of culture using the miRNAeasy Mini Kit (Qiagen, Hilden, Germany) and Qiazol lysis reagent ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The concentration of purified RNA was measured using a Qubit 4 fluorometer (QIAGEN K.K., Tokyo, Japan) with Qubit RNA BR Assay kits (QIAGEN K.K. ...
-
bioRxiv - Developmental Biology 2022Quote: The total RNA of 3-4 organoids was extracted using the RNeasy Plus Micro Kit (Qiagen), followed by reverse transcription to generate cDNA with GoScript Reverse Transcription Kit (Promega) ...
-
bioRxiv - Neuroscience 2020Quote: ... 6b and 6d and the Supplemental Figure 4 we used the RNAeasy Minikit (Qiagen; Cat#74104) following the manufacturer’s instruction.
-
bioRxiv - Cancer Biology 2020Quote: ... then spun at 14000K RPM for 10 minutes at 4°C to pellet debris (Qiagen, 37901). Protein concentration in the supernatant was quantified using BCA assay (Thermo Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... 4°C) and total RNA was extracted from the supernatant using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: Total hippocampus RNA was isolated from 4-month olds rats using RNeasy Lipid Tissue Kit (Qiagen) as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... followed by addition of 4 μg pBABE-hygro-hTERT prepared by maxiprep (Qiagen Canada, Mississauga, ON), to a final volume of 200 μl ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4°C) and supernatant was transferred to tubes containing 30µl precleared Ni-NTA agarose beads (Qiagen) in the presence of 0.05% Tween-20 and 15mM imidazole ...
-
bioRxiv - Developmental Biology 2020Quote: ... the rest of the embryo was fixed in 4% paraformaldehyde/PBS and stained with DAPI (Qiagen) for easy visualization of the somites under a microscope and characterization of the embryonic stage ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The concentration of purified RNA was measured using a Qubit 4 fluorometer (QIAGEN K.K., Tokyo, Japan) with Qubit RNA BR Assay kits (QIAGEN K.K. ...
-
bioRxiv - Microbiology 2020Quote: ... Cell pellets were recovered (5000g, 15 min at 4 0C) and lysed in QIAzol reagent (Qiagen). Total RNA was isolated using the RNeasy mini kit (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from cultures using the DNeasy UltraClean 96 Microbial Kit (Qiagen, Cat. #10196-4). The bacterial 16S rRNA variable region 4 (V4 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Plugs were allowed to solidify at 4°C and were then incubated with Proteinase K (QIAGEN) (1 h at 50°C and then overnight at 37°C) ...
-
bioRxiv - Immunology 2023Quote: RPMs (4 × 105 cells) were harvested and total RNA was extracted with RNeasy micro kit (QIAGEN). RNA libraries were prepared using TruSeq stranded mRNA Library Prep Kit (Illumina) ...
-
bioRxiv - Biochemistry 2023Quote: ... 4 OD600 of cells were harvested and RNA was extracted using the RNeasy Mini Kit (Qiagen) in conjunction with the RNase-Free DNase Set (Qiagen ...
-
bioRxiv - Molecular Biology 2022Quote: ... Further these lysates were incubated overnight at 4°C with prewashed Ni-NTA beads (Qiagen, 30210).Sequential washes with wash buffer 1-4 ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA was isolated (n = 3 or 4 mice per sample) using the RNeasy Mini Kit (QIAGEN), and aRNA was synthesized with Ambion’s MessageAmp aRNA Kit (Catalog # 1750 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µL of 10 mg/mL RNase A (DNeasy Blood &Tissue kit, #69504, Qiagen, Hilden, Germany) was added to each sample and incubated at 37°C for 2 h ...
-
bioRxiv - Plant Biology 2022Quote: ... 100mg of roots of 4-day-old seedlings according to the RNeasy Plant Mini Kit (Qiagen). cDNA was synthesized from 1µg of total mRNA using the QuantiNova Reverse Transcription Kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted from cultures using a DNeasy UltraClean 96 Microbial Kit (Qiagen, Cat. #10196-4). The 16S gene was amplified using primers 5’AGAGTTTGATCCTGGCTCAG and 5’GACGGGCGGTGWGTRCA ...
-
bioRxiv - Cancer Biology 2023Quote: ... For MdmX knockdown cells were transfected with FlexiTube siRNA Mdm4 (cat.#SI00037163, siMdmX#4) from QIAGEN or costume siRNA against MdmX (siMdmX#1 ...