Labshake search
Citations for Qiagen :
1951 - 2000 of 10000+ citations for C Reactive Protein ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: The QiaAmp viral Mini kit (Qiagen) or the PureLink Viral RNA/DNA Mini kit (ThermoFisher ...
-
bioRxiv - Microbiology 2024Quote: The DNeasy PowerSoil Pro Kit (Qiagen) was used to extract bacterial DNA from the fecal pellet by following the instructions of the manufacturer and was performed by author XM who at this stage was blinded ...
-
bioRxiv - Cancer Biology 2024Quote: ... and RNAeasy Mini Kit (Qiagen, #74104) and treated with RNase-free DNase (Qiagen ...
-
bioRxiv - Cancer Biology 2024Quote: ... or AllPrep DNA/RNA Kit (QIAGEN), respectively.
-
bioRxiv - Microbiology 2024Quote: ... Using QIAquick Nucleotide Removal kit (Qiagen), cDNAs were purified according to supplier instructions and then dried and resuspended in 6 µl of toeprint loading dye (95% formamide ...
-
bioRxiv - Bioengineering 2024Quote: ... The EndoFree Plasmid Maxi Kit (Qiagen) was used to prepare DNA for transfection.
-
bioRxiv - Microbiology 2024Quote: ... and an RNA cleanup kit (Qiagen) was used to achieve high-purity RNA ...
-
bioRxiv - Neuroscience 2024Quote: ... and Plasmid Miniprep Kit (27106, Qiagen).
-
bioRxiv - Cancer Biology 2024Quote: ... with the plasmid as per instructions and isolated by QIAGEN HiSpeed Plasmid Midi Kit (QIAGEN, 12643). LucOS-Blast vector was obtained from Dr ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were collected in triplicates and pellets were frozen at -80℃ for RNA extraction using Trizol and purification by Qiagen’s RNeasy mini kit (Qiagen #74106). Agilent’s Quick-Amp labelling Kit (Agilent #5190-0424 ...
-
bioRxiv - Cell Biology 2024Quote: ... using RNeasy Mini kit (QIAGEN #74104), total RNA was extracted from HAECs ...
-
bioRxiv - Pathology 2024Quote: ... using QIAwave RNeasy Mini Kit (Qiagen). RNA quality was determined initially using nanodrop ...
-
bioRxiv - Neuroscience 2024Quote: ... using an RNeasy Micro Kit (QIAGEN). Quality analyses and quantification of the extracted RNA were performed using a NanoDrop and Qubit Fluorometer (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2024Quote: ... The RNeasy MinElute Cleanup Kit (Qiagen) was used for further purification ...
-
bioRxiv - Microbiology 2024Quote: ... purified using PCR Cleanup kit (Qiagen), and quantification of DNA concentration using a Qubit HS kit (Invitrogen ...
-
bioRxiv - Bioengineering 2024Quote: ... and RNeasy Plus Mini Kit (Qiagen), respectively ...
-
bioRxiv - Neuroscience 2024Quote: ... DNeasy Blood & Tissue Kit (Qiagen, 69504) was used for DNA extraction following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: The DNeasy Blood & Tissue Kit (Qiagen) was used for Genomic DNA isolation ...
-
bioRxiv - Microbiology 2024Quote: ... using the RNeasy Plus kit (Qiagen). Swab samples were first thoroughly vortexed to stimulate release of the viral particles ...
-
bioRxiv - Microbiology 2024Quote: ... the RNeasy Plus Mini Kit (Qiagen) protocol was followed for all samples ...
-
bioRxiv - Microbiology 2024Quote: A DNeasy Blood & Tissue Kit (Qiagen) was used to extract DNA from each culture as per manufacturer’s protocol for Illumina sequencing ...
-
bioRxiv - Microbiology 2024Quote: ... The DNeasy PowerFood Microbial kit (Qiagen) was used to extract DNA from the colostrum and milk samples ...
-
bioRxiv - Biophysics 2024Quote: Using a RNeasy kit (Qiagen Inc.), RNA was isolated and subsequently quantified through absorbance measurements at 260 nm and 280 nm using a NanoDrop 1000 spectrophotometer (NanoDrop products ...
-
bioRxiv - Cell Biology 2024Quote: ... using an RNeasy Mini Kit (Qiagen) following the manufacturer’s protocol and RNA quantification was performed using a NanoDrop One (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2024Quote: ... QIAamp Viral RNA Mini Kit (Qiagen) was used ...
-
bioRxiv - Genomics 2024Quote: ... and Qiagen miRNeasy kit (Qiagen 217004). For spike-in normalization ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Cancer Biology 2021Quote: Protein lysate [1μg/μL] was RNase A digested at 37°C for 15 min following addition of 1 μg RNase A (Qiagen) per 25 μg protein ...
-
bioRxiv - Immunology 2021Quote: Conditioned medium of HEK293 cells producing recombinant sema3A fused with 6xHistidine tag in C-terminal was collected and purified using Ni-NTA agarose beads (QIAGEN). The protein activity was assessed using the cytoskeleton collapse assay (19 ...
-
bioRxiv - Genetics 2020Quote: ... Ligation was carried out overnight at 16°C followed by overnight cross-link removal with 20mg/ml Proteinase K (Qiagen). The samples were purified using phenol-chloroform and ethanol precipitated resulting in 3C libraries ...
-
bioRxiv - Genomics 2020Quote: ... 25ng of the purified product was subjected to self-ligation at 16 °C overnight in a total volume of 50uls and column purified using Qiagen (Qiagen) PCR purification kit as per manufacturers recommendations ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cell pellets were resuspended in lysis buffer and stored at -80°C before DNA or total RNA extraction with the Genomic DNA Mini (Blood/Culture Cell) (Genesis) or mRNAeasy (Qiagen) kits ...
-
bioRxiv - Biophysics 2022Quote: ... Purified protein was diluted in PBS buffer (pH = 7.2) and the fluorescence intensity was recorded at 60 °C in the Rotor-Gene 6600 real-time PCR cycler (Qiagen) for 18 h ...
-
bioRxiv - Genomics 2019Quote: ... with the addition of 20 μl of proteinase K (20 mg/ml) followed by incubation at 56°C for 1-2 hr and the mitochondrial DNA was extracted by Qiagen DNeasy Blood & Tissue Kit (QIAGEN Inc.) ...
-
bioRxiv - Microbiology 2019Quote: ... medium at 37°C and was made competent with rubidium chloride according to the method provided in the QIAexpressionist manual protocol 2 (Qiagen). When antibiotic selection was required ...
-
bioRxiv - Cell Biology 2019Quote: The decellularized Balb/c mouse pancreas scaffolds were washed in PBS and homogenized-lysed for 1 hr in Tissue homozilyser II (Qiagen). The ECM proteins were dissolved in lysis buffer containing Tris HCl 0.06M ...
-
bioRxiv - Genetics 2019Quote: ... Crosslinking was then reversed by overnight incubation at 65°C and DNA purified using QIAquick PCR purification column (Qiagen, 28104). Immunoprecipitated DNA was then quantified via Qubit (ThermoFisher ...
-
bioRxiv - Physiology 2019Quote: ... 72 °C - 10 min) and amplicons separated using a Qiaxcel Advanced Separation System using 15 - 3000 bp markers (Qiagen, UK).
-
bioRxiv - Biochemistry 2021Quote: ... The insoluble fraction was precipitated by ultracentrifugation (20,000 g) for 30 minutes at 4°C and the supernatant was loaded onto a Ni-NTA superflow affinity column (QIAGEN). The Ni-column was then wash three times and eluted with buffer containing 30 mM HEPES (pH 7.8) ...
-
bioRxiv - Neuroscience 2020Quote: ... at 60°C overnight and 1 μl of a 1:20 dilution of the lysate used in a PCR reaction (HotStarTaq, Qiagen). The sequence flanking the tmt-opsin1b TALEN binding sites was amplified using the forward 5’-GGGACTTTCTTTGCGCTTTA-3’ and the reverse 5’-CAGGTCAGAGCGGATCTCAT-3’ primers ...
-
bioRxiv - Biochemistry 2021Quote: ... the cell lysate was cleared by centrifugation (20000 rpm, 30 minutes, 4 °C) and purified using Ni2+-affinity chromatography (Ni-NTA superflow cartridges, Qiagen). Typically two 5 mL columns were used for a 2 L culture in which the lysate was loaded on the column washed with 10 CV wash buffer (50 mM Hepes ...
-
bioRxiv - Biochemistry 2021Quote: ... the cell lysate was cleared by centrifugation (20000 rpm, 30 minutes, 4 °C) and purified using Ni2+-affinity chromatography (Ni-NTA superflow cartridges, Qiagen). Typically two 5 mL columns (flow 5 mL/min ...
-
bioRxiv - Bioengineering 2021Quote: ... Exosome samples were treated with 1 µL RNAse A/T1 per 100 µL sample for 30 min at 37°C and lysed in 650 µL of QIAzol (Qiagen). To monitor the RNA recovery percentage as a function of the isolation procedure ...
-
bioRxiv - Biochemistry 2020Quote: ... The supernatant obtained after high speed centrifugation (20 000 x g for 30 min at 4 °C) was loaded on a gravity nickel-nitrilotriacetic acid (Ni-NTA) metal affinity column (Qiagen), washed with 10 column volumes (CV ...
-
bioRxiv - Plant Biology 2021Quote: ... The translation mixture was gently agitated in a microtube for 1 h at 4°C with a fivefold volume of Ni-NTA agarose (Qiagen) that had been equilibrated with a solution containing 50 mM Tris-HCl (pH 7.5 ...
-
bioRxiv - Microbiology 2020Quote: ... Purified extracellular WT and Δtgif2k-b tachyzoites were treated with vehicle or 5 μM sodium arsenite for 2 h at 37°C and total RNA was extracted using RNeasy (Qiagen). The RNA concentration for each sample was measured using Nanodrop One (Thermo Scientific) ...
-
bioRxiv - Genomics 2021Quote: ... Samples were incubated for 15 min at 37 °C to methylate accessible chromatin before the reaction was stopped with the addition of RLT plus buffer (Qiagen) and samples frozen down and stored at −80 °C before processing ...
-
bioRxiv - Biophysics 2021Quote: ... NF-κB molecules were immobilized through the 6xHis-tag on the C-terminus of RelA by penta-His antibody biotin conjugate (34440, Qiagen). For DNA-bound NF-κB experiments ...
-
Pou3f1 orchestrates a gene regulatory network controlling contralateral retinogeniculate projectionsbioRxiv - Developmental Biology 2022Quote: ... Sorted ßGal+ or GFP+ cells were collected in 1.5ml DNA LoBind® tubes placed at 4°C containing 400µl RLT buffer (Qiagen, 79216) with 1% β-Mercaptoethanol (Millipore Sigma ...
-
bioRxiv - Biochemistry 2022Quote: ... The Klenow polymerization reactions were incubated at 37 °C for 1 h and then purified on ion-exchange cartridges (cat. no. 28306; Qiagen). The 194 purified reactions were dissolved in 50 µL of water each and pooled to generate the 3,880 members library (DEL3880 ...