Labshake search
Citations for Qiagen :
151 - 200 of 10000+ citations for Mouse Marginal Zone B And B1 Cell Specific Protein MZB1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: The RNA was isolated from cultured cell lines or mouse tissues using the RNeasy Mini Kit from QIAGEN. This kit allows for efficient isolation of high-quality RNA from various sources.
-
bioRxiv - Cell Biology 2021Quote: ... Protein was extracted 48 hours post transfection with All Prep RNA/Protein Kit (Qiagen, USA). Protein concentrations were determined by Lowry assay (Bio-Rad ...
-
YAP promotes cell-autonomous immune responses to tackle intracellular Staphylococcus aureus in vitrobioRxiv - Cell Biology 2022Quote: ... protein extraction was performed using the Allprep RNA/Protein Kit (80404 Qiagen Inc., Hilden, Germany). Proteins (10–20 µg ...
-
bioRxiv - Molecular Biology 2022Quote: ... Protein was isolated from powdered tissues using the AllPrep DNA/RNA/Protein Mini Kit (Qiagen). Protein pellets were lysed in HES-SDS buffer (20 mM HEPES [pH 7.4] ...
-
bioRxiv - Cell Biology 2023Quote: Total RNA was isolated from the mouse cells/tissues and human cell lines using the RNeasy® Mini Kit (Qiagen Inc., Germantown, MD). For human platelets and MEG-01 cells ...
-
bioRxiv - Microbiology 2022Quote: ... 2 mL of logarithmic growth phase culture was pelleted by centrifugation and resuspended by vortexing in B1 buffer (Qiagen, Hilden Germany ...
-
Intrarenal B cells integrate in situ innate and adaptive immunity in human renal allograft rejectionbioRxiv - Immunology 2020Quote: ... and CD45+ Calcein+ DAPI-CD19+ CD38+ activated B cells were single-cell sorted into 96-well plates with catching buffer (RLT lysis buffer (Qiagen) with 1% 2-mercaptoethanol (Sigma-Aldrich)) ...
-
bioRxiv - Immunology 2024Quote: ... of either the B cell clone or polyclonal B cells of the patients were directly FACS sorted into 100µL ALT lysis buffer (Qiagen MicroKit). gDNA was extracted as per manufacturer’s instructions (Qiagen MicroKit) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Proteins were extracted from frozen mouse left ventricles using the TissueLyser LT (Qiagen) with 5mm stainless steel beads (69989 ...
-
bioRxiv - Microbiology 2019Quote: ... PCR specific bands were sliced from the gel and purified with the Qiagen Gel Extraction Kit (Qiagen, CA-EUA), following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 5 ng of cDNA was analyzed with isoform-specific dPCR assays and QIAcuity Probe PCR Kit according to manufacturer’s instructions (QIAGEN) in either 26k 24-well or 8.5k 96-well Nanoplates (QIAGEN) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and the full-length HA was amplified using gene-specific primers and the OneStep RT-PCR kit (Qiagen, #210212). The resulting PCR product was sequenced by Sanger sequencing (Genewiz) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Allele-specific expression was measured using RT-ddPCR with the One-Step RT-ddPCR Advanced Kit for Probes (Qiagen) on a QX200 ddPCR Droplet Reader (BioRad ...
-
bioRxiv - Neuroscience 2024Quote: ... 80k-100k events per reward-specific population were sorted directly into the RLT buffer (RNeasy Mini Kit; Qiagen; 74104) for downstream RNA extraction using RNeasy Mini Kit ...
-
bioRxiv - Genomics 2019Quote: We used Allprep DNA/RNA/Protein mini kit (Qiagen) for DNA isolations from FNAs and QIAamp DNA Kit for blood and plasma ...
-
bioRxiv - Biochemistry 2019Quote: ... RNA extraction with All Prep RNA/Protein Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... RNA and Allprep DNA RNA Protein Mini Kit (QIAGEN) extraction kit according to the manufacturer’s specifications.
-
bioRxiv - Genetics 2021Quote: ... The AllPrep DNA/RNA/Protein Mini Kit (Qiagen 80004) was used to extract total RNA in DEPC-treated water ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were lysed and recombinant proteins were purified under native conditions using the Ni-NTA Fast Start Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: Total RNA was extracted from fresh or cultured primary B cells using the RNeasy Minikit (Qiagen) or Trizol reagent (Ambion ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA was isolated from mouse brains with TRIzol or from selected cells with RNeasy Plus Mini Kit (Qiagen) and reverse-transcribed ...
-
bioRxiv - Bioengineering 2020Quote: Genomic DNA from mouse tissues and cultured HEK293 cells were extracted using DNeasy Blood & Tissue Kit (Qiagen, Germantown, MD). Total RNA was extracted from mouse tissues and HEK293 cells using Quick-RNA MiniPrep Kit (ZYMO Research ...
-
bioRxiv - Neuroscience 2020Quote: RNA from rat Schwann cell cultures or mouse nerve tissue was extracted using an RNeasy Micro Extraction Kit (Qiagen). RNA quality and concentration was determined after extraction using a nanodrop 2000 machine (Thermo) ...
-
bioRxiv - Molecular Biology 2020Quote: Total RNA was isolated from cultured cells or mouse kidneys using the total RNA extraction miRNeasy mini kits (Qiagen). cDNA synthesis was performed using the iScript cDNa synthesis kit (Bio-rad) ...
-
bioRxiv - Microbiology 2024Quote: Bacterial DNA was extracted from sorted cells and mouse fecal pellets using the AllPrep PowerFecal DNA/RNA kit (Qiagen) as previously described.13 Extracted DNA underwent library preparation and 16S rRNA gene sequencing of the V4-V5 hypervariable region with 515F/926R primers using the Illumina MiSeq PE250 system at the Université de Québec à Montréal (UQAM ...
-
bioRxiv - Plant Biology 2023Quote: ... Recombinant proteins were purified using the His-tag Protein Purification Kit (Ni-NTA Agarose, QIAGEN GmbH), GST-tag Protein Purification Kit (Glutathione Sepharose ...
-
bioRxiv - Molecular Biology 2023Quote: Total proteins from P5 hippocampi were purified with AllPrep DNA/RNA/Protein Mini Kit (Qiagen, 80004). The protein pellets were then resuspended in 90 μl Buffer ALO (Qiagen ...
-
bioRxiv - Genetics 2020Quote: ... mouse liver was purified using Gentra Puregene Kit (Qiagen) according to manufacturer’s instructions and combined for CHANGE-seq as previously described.37 Briefly ...
-
bioRxiv - Developmental Biology 2022Quote: ... A mouse neurogenesis PCR array kit (#PAMM-404AZA, Qiagen) was employed to measure the mRNA expression of genes involved in this pathway using real-time PCR (ABI 7500) ...
-
bioRxiv - Developmental Biology 2022Quote: ... MiRNA-specific PCR primers were purchased from Qiagen (miR-98-5p ...
-
bioRxiv - Genomics 2019Quote: ... Gene-specific siRNAs used: NF-YA (Qiagen, SI01327193), NF-YB (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... and gene-specific primer pairs obtained from Qiagen. Real-time qPCR reactions were then run on a CFX96 Real-Time System C1000 Thermal Cycler (Bio-Rad ...
-
bioRxiv - Physiology 2024Quote: ... using 350 microliter RLT buffer with 1% b-mercaptoethanol as a collection/lysis buffer (RNeasy micro kit, Qiagen). RNA was extracted following manufacturer’s instructions (RNeasy micro kit ...
-
bioRxiv - Microbiology 2021Quote: ... One step RT-qPCR for genomic viral RNA was performed using specific primer-probe sets and the QuantiFast Probe RT-PCR +ROX Vial Kit (Qiagen), in the Rotor-Gene Q (Qiagen ...
-
bioRxiv - Genomics 2020Quote: Bisulfite converted DNA was amplified with a region-specific biotinylated/unmodified DNA primer pair (Metabion; Supplemental Table S4) using the PyroMark PCR Kit (Qiagen) according to the manufactures instructions ...
-
bioRxiv - Microbiology 2019Quote: ... The complete 16S rRNA gene was amplified in specific strains after DNA extraction using the DNeasy Blood & Tissue kit (Qiagen), following the manufacturer’s recommendations ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: The contribution of liver tissue to cfDNA in clinical samples was analysed using a methylation-specific ddPCR assay [37] on bisulphite-converted cfDNA using the Epitect DNA bisulphite conversion kit (QIAGEN).
-
bioRxiv - Genetics 2020Quote: ... Analyses of HTT CAG repeat size in both HttQ111 mice and in patient fibroblasts was performed by PCR using human-specific HTT primers and Taq PCR Core Kit with Q solution (Qiagen), as previously described (17 ...
-
bioRxiv - Cancer Biology 2021Quote: ... specific to the DNA sequence (or cDNA sequence from reverse transcribed clone G2 RNA samples (QuantiTect Reverse Transcription Kit, Qiagen)) for PCR (PCR SuperMix High Fidelity ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA probes were PCR amplified using specific primers and gel purified using a Qiagen MinElute Gel Extraction Kit (Qiagen). EMSAs were performed by adding increasing amounts of purified OrhR-His6 fusion protein to a DNA probe (40 ng ...
-
bioRxiv - Developmental Biology 2022Quote: ... cells were washed with sterile PBS and lysed in RLT-lysis buffer for specific time points using the RNeasy kit (Qiagen) RNA isolation was performed as per the protocol ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... 161 birds were genotyped for alternative two-base pair variants (TG / CA) using an allele-specific PCR with the Multiplex PCR Kit (QIAGEN) and a set of primers (locus M1 ...
-
bioRxiv - Microbiology 2021Quote: ... One step RT-qPCR for both genomic and subgenomic viral RNA was performed using specific primer-probe sets and the QuantiFast Probe RT-PCR +ROX Vial Kit (QIAGEN), in the Rotor-Gene Q (QIAGEN ...
-
bioRxiv - Microbiology 2020Quote: ... The eluant was treated with DNase I (1 U/μl) to digest non-specific DNA and the bound DNA was purified from the complex via PCR Qiagen Kit (Qiagen). The purified DNA was amplified with primer sets specific to the prrF1,F2 promoter (Table S2 ...
-
bioRxiv - Microbiology 2019Quote: ... The HA and NA influenza segments (complete or fragments) were amplified from cDNA template using subtype-specific set of primers and purified with QIAquick PCR Purification kit (Qiagen). Nucleotide sequences of viral genes were determined using BrilliantDye™v3.1 Terminal Cycle Sequencing Kit (Nimagen) ...
-
bioRxiv - Microbiology 2021Quote: ... One step RT-qPCR for genomic viral RNA was performed using specific primer-probe sets and the QuantiFast Probe RT-PCR +ROX Vial Kit (QIAGEN), in the Rotor-Gene Q (QIAGEN ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... we designed strain-specific primers (see Supplementary Table 2) and generated overlapping amplicons using the OneStep RT-PCR Kit (Qiagen) and 5 µL of cDNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.2 uM gene specific primers pairs (hVDAC1, hVDAC2, hVDAC3, ß-actin) and 12.5 ul of master mix (QuantiFast SYBR Green PCR kit, Qiagen). Three independent experiments of quantitative real-time were performed in triplicate for each sample ...
-
bioRxiv - Neuroscience 2022Quote: ... The heavy-chain specific amplicon was isolated using electrophoresis with low-melting point agarose extraction with the QIAquick Gel Extraction kit (Qiagen). A secondary amplification was performed using a modification of the primers (VHH-Esp-For ...
-
bioRxiv - Microbiology 2024Quote: ... transposon junctions were amplified by using a transposon-specific primer (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCGGGGACTTATCAGCCAACC) and a primer P7 (CAAGCAGAAGACGGCATACGAGAT) using the HotStarTaq master mix kit (Qiagen). The himar1-enriched samples were diluted in a ratio of 1:50 ...