Labshake search
Citations for Qiagen :
101 - 150 of 10000+ citations for Mouse Marginal Zone B And B1 Cell Specific Protein MZB1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... All exon specific PCR products were purified using the Qiaquick PCR purification kit (Qiagen, Hilden, Germany) prior to sequencing.
-
bioRxiv - Immunology 2020Quote: SARS-CoV-2 ELISA was developed in-house using His tagged proteins bound on Ni-NTA HisSorb Strips or Plates (Qiagen). ELISA assay on mouse sera were performed with His-tagged SARS-CoV-2 full length Spike protein (produced in baculovirus ...
-
bioRxiv - Immunology 2023Quote: ... Remaining B cells were lysed and mRNA was extracted using TurboCapture plates (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: DNA was isolated from all the cell lines using AllPrep DNA/RNA/Protein Mini Kit (Qiagen). The samples were treated with sodium bisulfite to convert unmethylated cytosine residues to uracil via deamination using the EpiTect Bisulfite kit (Qiagen) ...
-
bioRxiv - Immunology 2021Quote: ... 150 ng DNA per reaction was amplified in duplicate using primers and probes specific to γHV68 Orf50 and mouse Ptger2 (see table) and 2× QuantiNova Probe Mastermix (Qiagen). Standard curves were obtained by serial dilutions of Orf50 and Ptger2 gBlocks (ORF50 ...
-
bioRxiv - Cell Biology 2023Quote: ... B) Proteinase K (Qiagen) diluted with PBS to 20 μg·ml-1 final concentration ...
-
bioRxiv - Cell Biology 2021Quote: AllPrep DNA/RNA/Protein Mini Kits (Qiagen) were used to extract total proteins from UVA-exposed and non-exposed HTEpC from all experiments ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were transfected with 25 nM or 50 nM siRNAs targeting specific genes: CASP3 (Qiagen, 1027417 ...
-
bioRxiv - Immunology 2021Quote: RNA was extracted from cells or mouse skin using the RNAeasy Plus universal kit (Qiagen 73404). RNA was quantified by absorbance at 260 nm ...
-
bioRxiv - Genetics 2021Quote: Total RNA was isolated from mouse aortas or cultured cells using an RNeasy mini kit (QIAGEN), per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: Total RNA was extracted from mouse tissues and single cell suspensions using RNeasy Plus kits (Qiagen). cDNAs were generated using SuperScript II (Invitrogen) ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from cultured human and mouse cells using an RNeasy Mini Kit (Qiagen) and included an on-column DNase treatment to eliminate contaminating genomic DNA ...
-
bioRxiv - Microbiology 2020Quote: ... mouse organ lysates and human primary cell supernatant samples were prepared in RNeasy Mini Kit (Qiagen) lysis buffer RLT (400μl) ...
-
bioRxiv - Neuroscience 2022Quote: ... Genomic DNA was isolated from Mouse Embryonic fibroblast cells (MEF) using QIAmp DNA mini kit (Qiagen), PCR amplified and subsequently cloned in vector pEGFPC1 with a constitutive promoter ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Lysates were incubated for 1 hr at 37°C after adding 10 µl of RNAse A (20 mg/ml) and proteins were precipitated with 200 µl of Protein Precipitation Solution (Qiagen Gentra Puregen Cell kit). After centrifugation ...
-
bioRxiv - Microbiology 2022Quote: ... Cytochrome b products were excised and purified from the gel using a commercial kit (QIAquick Gel Extraction Kit, Qiagen, Germany), followed by purification of eluted DNA using AMPure XP Magnetic Beads (1X ...
-
bioRxiv - Cancer Biology 2022Quote: Whole tissue protein was extracted by Qproteome Mammalian Protein Prep Kit (Qiagen, 37901) according to the manufacture’s guidelines ...
-
bioRxiv - Molecular Biology 2023Quote: ... and protein were extracted using the AllPrep DNA/RNA/Protein kit (Qiagen, #47054). Sample concentrations were measured with Qubit high sensitivity dsDNA and RNA platform ...
-
bioRxiv - Physiology 2022Quote: ... with validated gene-specific primers (Qiagen) on the QuantStudio™ 5 System ...
-
bioRxiv - Cell Biology 2023Quote: ... with validated gene-specific primers (Qiagen) on the QuantStudio™ 5 System ...
-
bioRxiv - Neuroscience 2023Quote: ... specific LNA PCR primer assays (Qiagen) for hsa-miR-451a ...
-
bioRxiv - Microbiology 2023Quote: Microbiome DNAs were extracted from the human samples on the same day of collection using the microbiome-specific kit (QIAamp DNA Microbiome Kit; Qiagen, Hilden, Germany). The DNA extraction was performed according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: DAFhi and DAFlo GC B cells (CD19+ CD20+ CD38+ IgD−) were resuspended in RLT cell lysis buffer (Qiagen) after flow cytometric sorting ...
-
bioRxiv - Molecular Biology 2024Quote: HBEC cells (5e5) from different treatments were mixed mouse RPE1 cells (5e5) for harvesting total RNA using RNeasy kits (Qiagen #74104) for reverse transcription with iScriptTM reverse transcription supermix (Bio-Rad #1708840 ...
-
bioRxiv - Microbiology 2021Quote: ... Transposon junctions were amplified by using a transposon specific primer Mariner_1R_TnSeq_noMm (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCGGGGACTTATCAGCCAACC) and P7 (CAAGCAGAAGACGGCATACGAGAT) primers with HotStarTaq Master Mix Kit (Qiagen). The following PCR condition was used ...
-
bioRxiv - Microbiology 2019Quote: ... Transposon junctions were amplified by using a transposon specific primer Mariner_1R_TnSeq_noMm (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCGGGGACTTATCAGCCAACC) and p7 primers (CAAGCAGAAGACGGCATACGAG) with HotStarTaq Master Mix Kit (Qiagen) with the following PCR condition (94 °C for 3 min ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was isolated from all the cell lines using AllPrep DNA/RNA/Protein Mini Kit (Qiagen). The total RNA was then treated with Turbo DNA-free kit (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: Genomic DNA was extracted from FACS-purified cells using Allprep DNA/RNA/protein mini kits from Qiagen. Sperm cells were lysed using differential extraction ...
-
bioRxiv - Immunology 2022Quote: ... or total IgDlo memory B cells were bulk sorted into Buffer RLT Plus (Qiagen) supplemented with 143 mM β- mercaptoethanol (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA was extracted from STHdh cells and mouse striatal tissues by using the RNeasy extraction kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: Total RNAs were extracted from AML12 cells and mouse livers using RNeasy Mini Kit (Qiagen, Venlo, Nederland) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: Total RNA was extracted from transfected 293T cells and frozen mouse testes using RNeasy Mini kit (QIAGEN). Extracted RNA was used for cDNA synthesis using iScript cDNA Synthesis kit (BIO-RAD ...
-
bioRxiv - Molecular Biology 2021Quote: HeLa cells were transfected with 40 nM specific human RBM10-siRNA5 or control AllStar siRNA (Qiagen) using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Immunology 2024Quote: SARS-CoV-2 specific T cell immune responses were evaluated by QuantiFERON SARS-CoV-2 (Qiagen) [36] ...
-
bioRxiv - Neuroscience 2020Quote: ... Total protein was extracted using the AllPrep DNA/RNA/Protein Mini Kit (Qiagen #80004) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total protein was purified by the AllPrep DNA/RNA/Protein Mini Kit (Qiagen: # 80004). Corresponding protein expression levels in the cells of different groups were detected by western blot using the following antibodies ...
-
bioRxiv - Cell Biology 2021Quote: ... and plasma membrane proteins were purified from cultured astrocytes using a commercially available kit (Qproteome Cell Compartment Kit; Qiagen, Inc, Germantown, MD, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: The All Prep DNA/RNA/Protein kit (QIAGEN) was used to total RNA from cell lines ...
-
bioRxiv - Cell Biology 2021Quote: ... Specific experimental points were used to extract total RNA using miRNeasy mini kit (cat. 217004-Qiagen, Hilden, Germany) in order to evaluate miR-184-3p upregulation upon transfection.
-
bioRxiv - Microbiology 2020Quote: ... MprA gene was amplified by PCR using Phusion high fidelity polymerase (Fermentas) with the specific primers (Rv0981_Fp-GTGCGAATTCTTGTCG, Rv0981_Rp-TCAGGGTGGTGTTTC)QIAquick Gel Extraction kit (Qiagen) was used to extract the amplicon and was cloned in pET28a+ vector (Novagen) ...
-
bioRxiv - Microbiology 2022Quote: ... and sgRNA-specific and universal primers (Table 1) and subsequently purified with the QIAquick PCR Purification Kit (Qiagen). sgRNAs mRNA was transcribed using AmpliScribe-T7 Flash Transcription kit (Epicentre) ...
-
bioRxiv - Cell Biology 2020Quote: ... total RNA was isolated from 5 × 105 cells with the AllPrep© DNA/RNA/Protein Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells from the inserts were lysed and collected into RLT buffer containing B-mercaptoethnaol (QIAGEN) for downstream molecular analyses by RT-qPCR.
-
bioRxiv - Cell Biology 2020Quote: ... using gene specific primers (QuantiTect®, Qiagen) and SyBr Green PCR master mix (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2019Quote: ... a specific miR166 LNA probe (QIAGEN, Germany) was used ...
-
bioRxiv - Cancer Biology 2020Quote: Genomic DNA from mouse bone marrow cells was extracted by the DNeasy Blood and Tissue Kit (Qiagen, #69504). The DNA region containing sgRNA target sites was amplified by PCR using specific primers (Zrsr2 Forward ...
-
bioRxiv - Microbiology 2021Quote: ... Cell-free cfDNA (both human and mouse) was isolated with QIAamp DSP Circulation NA Kit (QIAGEN, Hilden, Germany) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: Total RNA was extracted from cells or human or mouse brain tissues using RNeasy Mini kit (Qiagen, 74106). Reverse transcription was carried out using iScript Reverse Transcription Supermix (Bio-Rad ...
-
bioRxiv - Genomics 2024Quote: Genomic DNA was extracted from PGK12.1 mouse embryonic stem cells using the DNeasy blood and tissue kit (Qiagen), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: Total RNA was isolated from primary mouse endothelial cells using a commercially available kit (Qiagen, Valencia, CA, USA) followed by DNase I treatment ...