Labshake search
Citations for Qiagen :
151 - 200 of 2211 citations for L Phenylalanine N 1 oxo 4 1 pyrenyl butyl since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2022Quote: ... 1 μM oligo-dT18 (Qiagen) and 10 μM random hexamers (Promega).
-
bioRxiv - Biochemistry 2021Quote: ... 1% SDS (Qiagen P2 buffer). Neutralize lysis buffer by adding 300 μL of 4.2 M Guanidine HCl ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1 μl of DNase (Qiagen) was added ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 U Hotstar Taq (Qiagen), 1X Hotstar Taq buffer ...
-
bioRxiv - Microbiology 2023Quote: ... and 1 μM TSO (Qiagen). The master mix was dispensed using the MANTIS liquid dispenser followed by mixing for 1 min at 1800 rpm on a plate shaker (Biosan) ...
-
bioRxiv - Microbiology 2022Quote: ... 1 ml of QIAzol (Qiagen) was added to each pellet suspension before being transferred to Lysing Matrix B tubes (MP Biomedicals) ...
-
bioRxiv - Biochemistry 2023Quote: ... 1% SDS (Qiagen P2 buffer). Neutralize lysis buffer by adding 300 μL of 4.2 M Guanidine HCl ...
-
bioRxiv - Immunology 2024Quote: ... 1 mL RLT Buffer (Qiagen) was added to the thawed lungs ...
-
bioRxiv - Systems Biology 2021Quote: ... and 200 L of Buffer AL (QIAGEN) were added to each sample before mixing with a pipette ...
-
bioRxiv - Microbiology 2022Quote: ... 27620, 1:2,000 dilution) (rabbit anti-Spike S1, Cell Signaling, Cat #: 99423, 1:2,000 dilution) (mouse anti-Strep, Qiagen, Cat #: 34850, 1:2,000 dilution) (rabbit anti-ORF8 ...
-
“A Proteogenomic workflow reveals distinct molecular phenotypes related to breast cancer appearance”bioRxiv - Systems Biology 2020Quote: All breast cancer specimens (n = 21) were processed through AllPrep (Qiagen) protocol for the lysis and extraction of RNA and proteins (Fig 1D) ...
-
bioRxiv - Plant Biology 2021Quote: ... Protein extract (1 mg) was incubated with His6-RabD2c (1 μg) and Ni-NTA Agarose (QIAGEN) for 1 h at 4°C ...
-
bioRxiv - Microbiology 2020Quote: ... genomic DNA of FocnCong:1-1 was isolated using CTAB and 100/G genomic tips (QIAGEN) as described in the 1000 Fungal genomes project (http://1000.fungalgenomes.org) ...
-
bioRxiv - Microbiology 2021Quote: ... and incubated for 1 h at 55°C with 20 mg ml−1 proteinase K (Qiagen). Samples were treated for 10 min at 65 °C with 4 μl RNase A (100 mg ml−1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 µl 10x Taq buffer (Qiagen), 0.08 µl 10 mM dNTPs (NEB) ...
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen), and 0.2 μM of non-tailed primer ...
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen), and 0.2 μM of each of microsatellite forward and reverse primer ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 μM template-switching oligonucleotides (QIAGEN), and 1 M betaine (Sigma 61962) ...
-
bioRxiv - Cancer Biology 2021Quote: ... HIS-tag (Qiagen 34610 1:100) and HER3 (R&D Systems AF4518 1:400) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1 µM template-switching oligonucleotides (QIAGEN), and 1 M betaine ...
-
bioRxiv - Cell Biology 2021Quote: βPix siRNA – #1 - AACAATCAACTGGTAGTAAGA (Qiagen S104239011), #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen) and 0.2 μM of each primer pair ...
-
bioRxiv - Neuroscience 2023Quote: ... 5ug of Ribonuclease 1 (Qiagen, 19101) was added to each sample followed by staining with 20ug propidium iodide (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 x Qiagen PCR Buffer (Qiagen), 3 U APEX Taq (Genesee Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... containing 1 ml InhibitEx buffer (Qiagen). Two rounds of bead incubations were applied at 3.5 m/s for 2 min ...
-
bioRxiv - Systems Biology 2024Quote: ... NTA-agarose resin (1 mL) (Qiagen) was washed twice with 3 ml of distilled water and 2 ml of 100 mM FeCl3 in 0.1% acetic acid was added ...
-
bioRxiv - Developmental Biology 2024Quote: ... SFPQ siRNA #1 (Qiagen Cat#SI05783848), and SFPQ siRNA #2 (Qiagen Cat#SI05783876 ...
-
bioRxiv - Plant Biology 2024Quote: ... mixed with 1% beta-mercaptoethanol (Qiagen) using Kimble Chase glass tissue grinders (part# KT885450-0020) ...
-
bioRxiv - Neuroscience 2024Quote: ... SK-N-BE(2) cells and iNeurons with an RNeasy kit (Qiagen) using the manufacturer’s protocol including homogenization of samples with QIAshredder spin columns (Qiagen) ...
-
bioRxiv - Neuroscience 2022Quote: ... and samples were diluted 1:1 in 70% ethanol and purified using RNeasy columns and reagents (QIAGEN). RNA concentration was measured using a NanoDrop spectrophotometer ...
-
bioRxiv - Systems Biology 2022Quote: ... 12 μl of 1 M Tris-HCl (pH 6.5) and 1 μl RNAse A (Qiagen cat # 19101) were added to the sample and incubated for 30 min at 37 °C ...
-
bioRxiv - Cancer Biology 2021Quote: Liver tissue was homogenized in chloroform/methanol (2:1, 1 mL) using TissueLyser (Qiagen Ltd., Manchester, UK). Deionized water (400 uL ...
-
bioRxiv - Microbiology 2024Quote: ... approximately 1 × 109 CFU of bacteria were mixed at a 2:1 (vol:vol) ratio of RNAProtect (Qiagen) and incubated at room temperature for 5 min ...
-
bioRxiv - Cell Biology 2024Quote: ... Small pieces of tissue (~1×1 mm) were minced and placed in RLT Plus buffer (QIAgen, 1053393) supplemented with 140 mM 2-mercaptoethanol ...
-
bioRxiv - Cell Biology 2023Quote: ... and siNET1 #4 (Qiagen cat# SI00082040 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 1 mL of stabilization mix (RNAprotect Bacteria Reagent - Qiagen diluted with PBS in a 2:1 volume ratio) was applied on plates ...
-
bioRxiv - Genomics 2020Quote: ... PCR products were cleaned-up using 1:1 of SPRI beads and eluted in 30µl elution buffer (Qiagen). The resulting amplicons were assayed on the Fragment Analyzer System (Agilent) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 ml of the non-stressed culture was added to 1 ml of the RNAprotect Bacteria Reagent (Qiagen), vortexed and incubated for 5 min at room temperature ...
-
bioRxiv - Biochemistry 2024Quote: ... ∼8 ml PCR product (azide-DNA:2xbiotin-DNA = 1:1) was purified using HiSpeed Plasmid Maxi kit (Qiagen) in 1 ml NaHCO3 (pH 8.3) ...
-
bioRxiv - Neuroscience 2023Quote: ... Flow-through was mixed 1:1 with 70% ethanol and passed through a RNeasy Mini column (Qiagen, #74104). After centrifugation ...
-
bioRxiv - Microbiology 2020Quote: ... or MHV-A59 N gene using RT2 SYBR Green qPCR Mastermix (330502, Qiagen) in the Bio-Rad CFX96 system ...
-
bioRxiv - Neuroscience 2020Quote: ... n=3) using the RNeasy Mini kit (Cat. No. 74104, QIAGEN, Hilden, German) and manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... His-N-WASP was first isolated using Ni-NTA beads (Qiagen, Valencia, CA) using a buffer with an imidazole gradient (20 mM Bis-Tris ...
-
bioRxiv - Immunology 2021Quote: RNA was extracted with RNeasy Mini kit (cat. n° 74106, Qiagen, Hilden, Germany), treated with the TURBO DNA-free™ kit (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2021Quote: ... DNA was extracted using Qiagen 96-well DNeasy kits (Qiagen P/N 69581). Sequencing libraries were prepared using the Illumina Nextera Kit and custom barcoded adapter sequences ...
-
bioRxiv - Cancer Biology 2020Quote: ... and RPR2 (n=6) primary tumors was performed using RNeasy Mini Kit (Qiagen) with the standard protocol ...
-
bioRxiv - Developmental Biology 2020Quote: ... HF n=8) using the Qiagen RNeasy Plus Mini Kit (Qiagen, Toronto ON). RNA was quantified by spectrophotometry (DeNovix ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.1% N-Lauroylsarcosine salt and 0.2% Triton-X100 and passed through Miniprep (QIAGEN) silica-fibre membrane spin columns in order to bind only the Top2cc’s and not DNA ...
-
bioRxiv - Neuroscience 2024Quote: ... and the mouse hippocampal tissues (n=5-6/group; Qiagen, Germantown, MD, USA). The samples of the RNA (500ng/µL ...