Labshake search
Citations for Qiagen :
51 - 100 of 2211 citations for L Phenylalanine N 1 oxo 4 1 pyrenyl butyl since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... leaf tissues were collected and homogenized in 400 μL of TPS buffer (100 mM Tris-HCl, 10 mM EDTA, 1 M KCl, pH8.0) using TissueLyser II (Qiagen), followed by incubation for 20 min at 75°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... Clarified bacterial lysates from a 1 l culture were bound to a 0.5 ml column of Ni-NTA resin (Qiagen) by gravity flow ...
-
bioRxiv - Molecular Biology 2022Quote: ... and isolated keratinocytes and fibroblasts from the skin and Wound7 (n = 5/each group) (Table 1 and Table S1) by using the miRNeasy Mini kit (Qiagen, Hilden, Germany) and prepared for library construction ...
-
bioRxiv - Genetics 2022Quote: ... Midi, 3-4 ml of blood) and Puregene (0.3-1 ml of blood, manual extraction) (Qiagen, Cat# 1057048 ...
-
bioRxiv - Bioengineering 2020Quote: ... Each well is then diluted with 1 to 4 v:v in RNAse free elution buffer (QIAgen) to a total volume of 8 µL ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA from patient material (n=3) and organoids (p1 and p2 n=3, p3 n=2) was extracted (RNeasy™ Mini Kit, Qiagen). To obtain cDNA ...
-
bioRxiv - Genomics 2022Quote: ... Day 145) for n=4 clams for each treatment (Figure 2) using the Qiagen DNeasy Blood and Tissue Kit (Qiagen USA) according to manufacturer’s instructions with slight modifications ...
-
bioRxiv - Neuroscience 2022Quote: Total RNA was isolated from NPCs and their derived astrocytes (4 lines, n=3 per cell type) using a RNeasy mini kit (Qiagen, 74104). RNA samples were prepped using TruSeq® Stranded mRNA Library kit (Illumina ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA was extracted from patient tissue samples and flash frozen mouse xenograft tumor samples (n = 4) using the RNeasy kit (Qiagen; #74104) and converted to cDNA using the qScript cDNA Synthesis kit (Quantabio ...
-
bioRxiv - Systems Biology 2024Quote: Knockdown of ITPRIPL2 and GFP were induced in nHDF (N=4 for each condition) and HeLa cells (N=4 for each condition) and RNA was isolated with the RNeasy Mini kit (Qiagen, 74104) including DNAse treatment ...
-
bioRxiv - Microbiology 2022Quote: ... and 150 μL DMEM supplemented with 2% FBS and homogenized using a TissueLyser II (2 cycles at 30 Hz, 1 min, Qiagen). Homogenates were clarified by centrifugation and frozen until plaque assay titration ...
-
bioRxiv - Microbiology 2020Quote: ... The soluble fraction was incubated for 1 hour at 4 °C using a Ni-NTA resin (Qiagen). The Ni-NTA resin was washed with 4 times resin volume (RV ...
-
bioRxiv - Genomics 2022Quote: ... and homogenized at 25/s for 1 min at 4°C using a TissueLyser II (Qiagen, 85300). Samples were incubated at room temperature for 5 min followed by addition of 180 μl chloroform ...
-
bioRxiv - Cell Biology 2024Quote: ... 4 μL of cDNA was added to 1 μL of pre-purchased primers (QuantiTect primers (Qiagen, Germany)) and qPCR was carried using the StepOnePlus machine (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... RT buffer 5x (4 μL) RT primer mix and Reverse transcriptase (1 μL) (Qiagen, Cat. No. 205311) added in a final volume of 20 μL ...
-
bioRxiv - Genomics 2020Quote: ... and AH (20 weeks) old C57/Bl6/J mouse hearts (n= 4-6/group) using the RNeasy Mini Kit (Qiagen, Cat.74106) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA was isolated from TG and NTG mice (n=4/group) at 6 months of age using the RNeasy Mini Kit (Qiagen, Cat.74106) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... containing Protease inhibitor cocktail (PIC, Complete, 1:25) and lysed at 4°C using a TissueLyser LT (Qiagen) on 50 Hz for 2 min ...
-
bioRxiv - Biochemistry 2022Quote: ... 4 °C for 1 h and purified by affinity chromatography using a 5 ml Ni-HP column (Qiagen). Flow through with pure AstaPo1 was collected and dialyzed overnight against the buffer containing 50 mM Tris pH 7.6 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1% CA630) and rotated at 4°C for 2 hours before addition of His-beads (Ni-NTA, QIAGEN). After continuous rotating for another 2 hours ...
-
bioRxiv - Systems Biology 2020Quote: Total RNA was extracted from hypothalamus and hippocampus (n = 4 per dietary group per tissue; total 32 samples) using an All-Prep DNA/RNA Mini Kit (QIAGEN GmbH, Hilden, Germany). Sample size was based on previous RNA-Seq studies in which findings were validated using qPCR and gene perturbation experiments [6 ...
-
bioRxiv - Neuroscience 2022Quote: Total RNA was extracted from the hippocampus and cortical regions of Ctrl WT and cKO mice (n=4 per group) using the RNeasy kit (Qiagen, Valencia, CA, USA) method (see location of cortical areas 1 and 2 in the Supplementary Figure 1) ...
-
bioRxiv - Molecular Biology 2022Quote: ... An aliquot of cells was diluted to OD600 0.3 and 500 µL of diluted cells was added to 1 mL of RNAprotect Bacteria Reagent provided in the RNeasy Mini Kit (Qiagen; catalog #74104). Protocols provided in the “RNAprotect Bacteria Reagent Handbook 2015” were used for RNA extraction (“Protocol 1”) ...
-
bioRxiv - Physiology 2021Quote: ... 10-50 mg tissue was homogenized (1 mM EDTA and 4 mM sodiummetabisulfite, pH 7.4) using a TissueLyser II (Qiagen). Samples where adjusted to the same weight/volume percentage by adding a volume of homogenization buffer and the NA content was measured by ELISA (BA E-5200 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA was isolated at 6 time points (0, 0.5, 1, 2, 4, and 8 hours) using the RNeasy Mini kit (Qiagen) according to the manufacturer’s recommended protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... The lysates were cleared for 30 min at 45,000 × g at 4°C and incubated with 1 ml of Ni-NTA agarose beads (Qiagen) per 1 l of expression culture for 2 h rotating at 4°C ...
-
bioRxiv - Biochemistry 2021Quote: ... Lysates were clarified by centrifugation for 1 h at 4°C at 10,000 rcf before being subjected to Ni-NTA (Qiagen) affinity purification following the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2023Quote: ... 4°C) and the supernatant incubated 1 hr at 4°C with 1.5 ml packed Ni-NTA Agarose beads (Qiagen). Beads were washed with buffer H adjusted to 50 mM imidazole ...
-
bioRxiv - Developmental Biology 2021Quote: ... Lower jaws were resuspended in 600 μl of RTL plus buffer supplemented with 1% β-mercaptoethanol (M3148-100ML, MilliporeSigma, Burlington, MA, USA) and Reagent DX (19088, Qiagen, Hilden, Germany). HH31 and HH34 lower jaws were processed in a Bead Mill 24 Homogenizer (15-340-163 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Lower jaws were resuspended in 600 μl of RTL plus buffer supplemented with 1% β-mercaptoethanol (M3148-100ML, MilliporeSigma, Burlington, MA, USA) and Reagent DX (19088, Qiagen, Hilden, Germany). HH31 and HH34 lower jaws were processed in a Bead Mill 24 Homogenizer (15-340-163 ...
-
bioRxiv - Plant Biology 2021Quote: ... The translation mixture was gently agitated in a microtube for 1 h at 4°C with a fivefold volume of Ni-NTA agarose (Qiagen) that had been equilibrated with a solution containing 50 mM Tris-HCl (pH 7.5 ...
-
bioRxiv - Genetics 2022Quote: ... The tissue powder was then transferred to a 1.5 mL centrifuge tube where 400 μL of 1% PVP-40 Buffer AP1 solution and 4 μL of RNase A were added (Qiagen DNeasy Plant Kit Qiagen Inc ...
-
bioRxiv - Plant Biology 2020Quote: ... After vortexing the samples for 10 s and lysing the tissue with 4 mm glass beads for 1 min at 30 Hz in the TissueLyser II (Qiagen), 400 μL of Tris-HCl pH:7.5 were added and the samples were again mixed for 1 min in the TissueLyser ...
-
bioRxiv - Immunology 2020Quote: RNA was extracted from isolated neutrophils after the 1 and 4 hour EC challenges as well untreated controls using the miRNeasy Micro kit from Qiagen and libraries were generated using KAPA PolyA enrichment mRNA library prep ...
-
bioRxiv - Genomics 2021Quote: ... To eliminate lipids supernatants were applied to a RNeasy column and centrifuged at 10,000 rpm and 4 °C for 1 min (Qiagen, 74104). The flow through was collected and protein concentrations were assessed using the Bradford assay ...
-
bioRxiv - Biochemistry 2021Quote: ... The clarified extract was supplemented with 10 mM imidazole and rotated for 2 hours at 4 °C with 1 ml of Ni-NTA beads (Qiagen). Bound protein was eluted with 10 CV of buffer L / 200 mM imidazole ...
-
bioRxiv - Neuroscience 2021Quote: ... and 0.4 mg/mL Proteinase K (55°C for 1 hour) before being purified using the QIAquick PCR purification kit (QIAGEN). qPCR was performed on the Rotor-Gene 3000 (Corbett Life Science ...
-
bioRxiv - Biophysics 2022Quote: ... The resulting mixture was rotated at 4 °C for 60 min and then poured into a 1 mL polypropylene column (Qiagen). The resin was washed three times with 5 mL lysis/wash buffer and eluted in 0.25 mL fractions with Ni-NTA elution buffer (composition same as lysis/wash buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... The remaining supernatant was centrifuged again at 5,000 x g for 20 minutes at 4°C and equilibrated for 1 hour in 3 mL of Ni-NTA resin (Qiagen) that was pre-equilibrated in the extraction buffer ...
-
bioRxiv - Microbiology 2024Quote: ... Bacteria are harvested by centrifugation (5 minutes, 4°C) and washed with 1 ml cold PBS containing RNA stabilization reagents (RNAprotect, Qiagen) before flash freezing and storage at -80°C ...
-
bioRxiv - Biochemistry 2024Quote: ... The cell pellet was removed after centrifugation (16000 rpm, 4 °C, 1 h) and supernatant was loaded into a Ni-NTA agarose column (Qiagen). Protein was eluted in an elution buffer (50 mM Tris-HCl ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... previously coated with the anti-B55δ antibody (1 hour incubation at 4°C, followed by extensive washes) and Nickel beads (Qiagen) coated with 400 μg of 6XHIS-S67thio-S109A-XeARPP19 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Prior to RNA extraction individuals were homogenized in 200 μl homogenization buffer including 4 μl 1-Thioglycerol using a TissueLyser II (Qiagen) with a mixture of five 1 mm zirconia (BioSpec Products ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Digoxigenin (DIG)-labelled probes were denatured at 90°C for 4 min and diluted with 1 x microRNA ISH buffer (Qiagen), following protocol by Endisha & Kapoor ...
-
bioRxiv - Immunology 2024Quote: Bladders were weighed and homogenized in 1 mL of sterile PBS at 4°C using a handheld rotor-stator tissue homogenizer (TissueRuptor II, Qiagen). Homogenates were serially diluted ...
-
bioRxiv - Genetics 2020Quote: ... 1 µl 1 mg/ml Carrier RNA (QIAGEN), 1 µl 10% SDS ...
-
bioRxiv - Immunology 2020Quote: ... Pellets were lysed by vortexing for 1 minute in 350uL cold supplemented RLT buffer (RLT + β-MeOH) at 4°C and lysates homogenized using QIAshredder columns (Qiagen). RNA was then extracted from these samples using the RNeasy Plus Micro kit (Qiagen ...
-
bioRxiv - Cancer Biology 2022Quote: ... after which we select the top 250 genes for which the correlation coefficient was positive and the top 250 genes for which the correlation coefficient was negative. The final step of the pipeline (Fig. 1 (4)) analyzes these genes by using Ingenuity Pathway Analysis (IPA, QIAGEN, [27]) to interpret the canonical pathways.
-
bioRxiv - Cancer Biology 2024Quote: RNA was extracted from OSU-CLL cells (1.5e6 cells/mL) treated with DMSO or SpiD3 (1, 2 μM; 4 h) using the miRNeasy Mini Kit (Qiagen; Hilden, Germany) per manufacturer instructions and processed using the Universal Plus mRNA-Seq with NuQuant kit (Tecan ...