Labshake search
Citations for Qiagen :
151 - 200 of 1818 citations for Human TGF beta 3 TGFB3 qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... with beta-actin as a reference gene (QuantiFast SYBR Green PCR Kit; Qiagen) on a Roche LightCycler 480 ...
-
bioRxiv - Cancer Biology 2021Quote: ... using predesigned Quanititect Primer assays (Qiagen) to the following murine genes ...
-
bioRxiv - Molecular Biology 2021Quote: ... and QuantiTect primer assays (Qiagen, 249900) that were used for lncRNA and mRNA expression analysis are listed in Additional file 1 ...
-
bioRxiv - Cell Biology 2021Quote: ... The following miScript Primer Assays (Qiagen) were used ...
-
bioRxiv - Systems Biology 2020Quote: ... Primers used were ordered from Qiagen, including GATA4 (QT00031997) ...
-
bioRxiv - Cancer Biology 2022Quote: ... The primers were: Hs_AREG (Qiagen; #QT00030772); Hs_PIDD1 (Qiagen ...
-
bioRxiv - Physiology 2021Quote: ... All primers were purchased from Qiagen.
-
bioRxiv - Immunology 2021Quote: ... and random hexamer primers (Qiagen, 79236) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... All primers were purchased from Qiagen.
-
bioRxiv - Cell Biology 2021Quote: ... All primers were purchased from Qiagen website ...
-
bioRxiv - Cell Biology 2020Quote: ... Predesigned QuantiTect® Primer Assays (Qiagen) were used for all genes ...
-
bioRxiv - Molecular Biology 2021Quote: ... The following primer sets from Qiagen were used ...
-
bioRxiv - Physiology 2022Quote: ... with validated gene-specific primers (Qiagen) on the QuantStudio™ 5 System ...
-
bioRxiv - Molecular Biology 2024Quote: ... Validated primers were obtained from Qiagen, UK for the miRNAs ...
-
bioRxiv - Developmental Biology 2023Quote: ... ilp8 primers used from Qiagen (QT00510552), dmyc forward primer (AACGATATGGTGGACGATGG) ...
-
bioRxiv - Biochemistry 2023Quote: ... The U6 snRNA primer from Qiagen was used for normalization ...
-
bioRxiv - Cell Biology 2023Quote: ... with validated gene-specific primers (Qiagen) on the QuantStudio™ 5 System ...
-
bioRxiv - Neuroscience 2023Quote: ... specific LNA PCR primer assays (Qiagen) for hsa-miR-451a ...
-
bioRxiv - Molecular Biology 2023Quote: ... we purchased commercial primers from Qiagen. Primers for mouse Sprr1a (GeneCopoeia ...
-
bioRxiv - Neuroscience 2023Quote: ... LNA™ PCR primer set (Qiagen). PCR amplification and detection were performed with the Applied Biosystems StepOnePlus Real-Time detector ...
-
bioRxiv - Immunology 2023Quote: ... Pre-synthesized QuantiTect primers from Qiagen were used for il12b ...
-
bioRxiv - Genetics 2024Quote: ... Dm_miR-8_1 miScript Primer assay (QIAGEN), and Dm_miR-14_1 miScript Primer assay (QIAGEN ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The primers were purchased from Qiagen (Catalogue number ...
-
bioRxiv - Neuroscience 2024Quote: ... Mouse ATP7A: Primers purchased from Qiagen with Cat # Mm_Atp7a_1_SG QuantiTect Primer Assay (QT00152677 ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Microbiology 2021Quote: ... Transposon junctions were amplified by using a transposon specific primer Mariner_1R_TnSeq_noMm (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCGGGGACTTATCAGCCAACC) and P7 (CAAGCAGAAGACGGCATACGAGAT) primers with HotStarTaq Master Mix Kit (Qiagen). The following PCR condition was used ...
-
bioRxiv - Cell Biology 2024Quote: ... 4 μL of cDNA was added to 1 μL of pre-purchased primers (QuantiTect primers (Qiagen, Germany)) and qPCR was carried using the StepOnePlus machine (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2024Quote: ... All the primers (forward, reverse and sequencing primers) were designed with the PyroMark Assay Design software (Version 2.0.1.15, Qiagen) using the assay type "Methylation Analysis" (CpG ...
-
bioRxiv - Biophysics 2024Quote: ... and bioinformatically validated specific primers (Gapdh, QT00199388; Rpl13a, QT00267197; Ifnb1, QT00249662; Trex1, QT00288967; QuantiTect Primer Assay, Qiagen). The final volume was 20 µL and the cycling conditions were a holding stage of 95°C for 15 min ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757, human YTHDF3: QIAGEN SI04133339 ...
-
bioRxiv - Cancer Biology 2021Quote: ... RT-qPCR reactions were run using a QuantiTect SYBR Green RT-qPCR kit (Qiagen, 204243) on a Qiagen Rotorgene Q ...
-
bioRxiv - Cancer Biology 2022Quote: ... RT-qPCR reactions were run using the QuantiTect SYBR Green RT-qPCR kit (Qiagen, 204243) on a Qiagen Rotor-Gene Q ...
-
bioRxiv - Genomics 2022Quote: Genomic DNA for Illumina mate-pair sequencing was extracted using the DNeasy Plant Mini Kit (Qiagen) from 8-week-old leaves of ALO seedlings ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 30 uL/well 1 X lysis buffer (1x Qiagen TCL, 1% beta-mercaptoethanol) was added ...
-
bioRxiv - Immunology 2024Quote: ... ∼1000 macrophages were sorted into 75µL of RLT buffer (Qiagen, containing 1% beta-mercaptoethanol), vortexed for 1 min and immediately frozen (−80°C) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... cDNA samples were amplified in technical duplicates in presence of gene specific primers (QuantiTect® Primer Assays, Qiagen) and QuantiTect® SYBR Green Master Mix (Qiagen ...
-
bioRxiv - Developmental Biology 2022Quote: ... Primers for qRT-PCR were designed using the Primer Quest tool (Integrated DNA Technologies) and SYBR Green (Qiagen) was used as the DNA intercalating dye ...
-
bioRxiv - Bioengineering 2023Quote: ... Primers for qRT-PCR were designed using the Primer Quest tool (Integrated DNA Technologies) and SYBR Green (Qiagen) was used as the DNA intercalating dye ...
-
bioRxiv - Cancer Biology 2021Quote: ... Mir-103 (Qiagen primer Cat. No. YP00204306) was used as reference miRNA ...
-
bioRxiv - Cell Biology 2020Quote: ... using gene specific primers (QuantiTect®, Qiagen) and SyBr Green PCR master mix (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... and commercially available miScript primer assays (Qiagen) targeting miR-39 and the 5 top ranked candidate miRNAs ...
-
bioRxiv - Cell Biology 2022Quote: ... Hs_ARHGEF40_1_SG and Hs_STARD8_1_SG QuantiTect Primer Assays (Qiagen) were used to detect the ARHGEF40 and the STARD8 transcripts ...
-
bioRxiv - Neuroscience 2021Quote: ... Validated primer sets were obtained from Qiagen.
-
bioRxiv - Bioengineering 2021Quote: ... QuantiTect primers were all purchased from Qiagen: B2m (QT01149547) ...
-
bioRxiv - Neuroscience 2020Quote: ... The following primers were purchased from Qiagen: miR-663b (MS00037884) ...
-
bioRxiv - Neuroscience 2020Quote: ... The following primers were purchased from Qiagen: SOX2 ...
-
bioRxiv - Immunology 2020Quote: ... β-actin (pre-designed primers from Qiagen); HPRT(Eun et al. ...
-
bioRxiv - Immunology 2021Quote: ... QuantiTect Primer Assays were purchased from Qiagen. Primer information is summarized in table 2.
-
bioRxiv - Neuroscience 2020Quote: ... 1 μM barcode LNA RT primer (Qiagen), 1U/μL RiboLock RNase inhibitor (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: EpiTect Methyl II PCR Primer Assay (Qiagen) was performed according to the manufacturer’s protocol ...