Labshake search
Citations for Qiagen :
401 - 450 of 1818 citations for Human TGF beta 3 TGFB3 qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... qPCR was performed using Taq PCR Master Mix kit (Qiagen), TaqMan Gene Expression Assay probes (cat ...
-
bioRxiv - Developmental Biology 2023Quote: ... qPCR was performed using Quantitect SYBR Green PCR kit (QIAGEN) and a QuantStudio 3 Flex RT PCR System (Applied Biosystems) ...
-
bioRxiv - Bioengineering 2023Quote: ... The qPCR was performed using a RotorGene® (Qiagen N.V.). Data was analysed by studying the Ct values from amplification curves ...
-
bioRxiv - Microbiology 2024Quote: ... RT-qPCR was performed using QuantiNova Probe PCR Kit (Qiagen) or SYBR Premix Ex Taq II Kit (Takara ...
-
bioRxiv - Biophysics 2024Quote: ... cDNA was amplified using Quantifast SYBR green qPCR kit (Qiagen) with specific primers for Piezo1 and ribosomal protein L3 (RPL3) ...
-
bioRxiv - Microbiology 2024Quote: ... qPCR was carried out using a Rotor-gene Q (QIAgen) with the following cycling conditions ...
-
bioRxiv - Neuroscience 2024Quote: ... Viral titers were measured by qPCR (Rotor-Gene Q, QIAGEN).
-
bioRxiv - Cancer Biology 2024Quote: ... qPCR was performed using QuantiNova SYBR green (208052, Qiagen, UK) and canine-specific primers (Table 1) ...
-
bioRxiv - Genetics 2024Quote: ... For qPCR runs performed using the RotorGene Q instrument (Qiagen), the reaction volume was doubled and contained ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-TGGTTCTACATCAGAGTTGTT-3’ (Qiagen). Lentiviral particles expressing SMART vectors doxycyclin-inducible shRNA were from Dharmacon as follows ...
-
bioRxiv - Plant Biology 2021Quote: ... Fluorescence positive cells were collected in a round-bottom polystylene tube that contains 150 - 200 μl RLT buffer with beta-mercaptoethanol (10 μl / 1 ml RLT buffer, RNeasy micro kit protocol, Qiagen). Cell sorting was performed for about 15 min and collected cells were immediately frozen on dry ice and kept in −80 °C for up to one week ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... per condition or genotype were homogenized in 2-ml Eppendorf tubes containing lysis buffer with 1% beta-mercaptoethanol using a TissueLyser LT bead mill (Qiagen) and 5-mm stainless steel beads (Qiagen #69989) ...
-
bioRxiv - Developmental Biology 2022Quote: ... from rraga mutants or wildtype siblings were sorted using BD FACSAria II directly into lysis buffer (RLT+beta-mercaptoethanol) from Qiagen RNeasy Micro Kit (74004) ...
-
bioRxiv - Physiology 2021Quote: ... Shredded bone marrow cells were frozen (−80°C) in RLT buffer (1% beta-mercaptoethanol) until RNA extraction using RNAeasy mini kit (Qiagen). RNA integrity number (RIN ...
-
bioRxiv - Immunology 2024Quote: ... semimature SP thymocytes were isolated on BD FACSAria II and BD FACSAria Fusion cell sorters directly into RLT + 1% beta-mercaptoethanol (BME) buffer (Qiagen). Libraries were generated by the Emory Integrated Genomics Core (EIGC ...
-
bioRxiv - Physiology 2020Quote: ... Erythrocytes were lysed for 3 minutes with 3 ml of EL buffer (Qiagen). After Fc blocking for 20 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3’mRNA-seq libraries were prepared using QIAseq UPX 3’ Transcriptome Kit (QIAGEN). In brief ...
-
bioRxiv - Immunology 2023Quote: ... The first round of PCR was carried out using the ImmunoSEQ proprietary PCR primer mix (32 μL per sample containing 25 uL of QIAGEN 2× Multiplex PCR Master Mix, 5μL of QIAGEN 5x Q-solution and 2 μL of primer mix). A positive control reaction ...
-
bioRxiv - Genomics 2020Quote: ... 5 pM of each primer and 2.0 U HotStar Taq polymerase (Qiagen) in a 25 µl volume or 1X Phusion U Hotstart (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA was synthesized using random primers and QuantiTect Reverse Transcription kit (Qiagen). Quantitative PCR (qPCR ...
-
bioRxiv - Neuroscience 2020Quote: ... with 1 µL cDNA using the following oligonucleotides (QuantiTect Primer Assays, Qiagen): Gli1 (Gli1 ...
-
bioRxiv - Genomics 2020Quote: ... Jun was amplified using pre-designed primers from Qiagen (cat no. QT00296541).
-
bioRxiv - Microbiology 2020Quote: ... ICAM and P-Selectin were from the QuantiTect primer assay kit (Qiagen). Results are expressed following normalization using 18S RNA.
-
bioRxiv - Cell Biology 2021Quote: ... random hexamer primers and reverse transcriptase QuantiTech RT Kit (Qiagen, Germantown, MD). Quantitative PCR was performed using the 7800HT (Applied Biosystems ...
-
bioRxiv - Immunology 2022Quote: ... These primers were designed using the PyroMark Assay Design 2.0 software (Qiagen). PCR amplicons were pyrosequenced using the PyroMark Q48 system and analyzed with PyroMark Q48 Autoprep software.
-
bioRxiv - Neuroscience 2020Quote: ... and 2.5 μL of nuclease-free water containing predesigned primers (#249900, Qiagen; QuantiTect Primer Assays IL-6 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Pyrosequencing primers were designed using the PyroMark Assay Design Software 2.0 (Qiagen). 500ng of genomic DNA was subjected to bisulfite conversion using the EpiTect Bisulfite Kit (Qiagen ...
-
bioRxiv - Neuroscience 2020Quote: ... HIF-1α (#QT01039542) and VEGF (#QT00160769) were analyzed using primers from Qiagen. Primers for all other genes investigated are listed in the table below:
-
bioRxiv - Immunology 2021Quote: ... These primers were designed using the PyroMark Assay Design 2.0 software (Qiagen). PCR amplicons were pyrosequenced using the PyroMark Q48 system and analyzed with PyroMark Q48 Autoprep software.
-
bioRxiv - Cancer Biology 2022Quote: ... primer array of the RT2 Profiler PCR Array (#PAMM-025ZD, Qiagen, Germany) was used according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... which used PyrG (CTP synthase) primers and HotStarTaq PCR reagents (QIAGEN, #203203). DNA samples were quantified then diluted to 20 ng/µL so that 5 µL could be used in each 25-μL PCR reaction ...
-
bioRxiv - Immunology 2024Quote: ... STAT2 and 18s rRNA were measured using validated gene-specific primers (QIAGEN). Primers for ACAT1 ...
-
bioRxiv - Microbiology 2024Quote: ... Expression levels were measured by quantitative PCR using pre-designed primers (Qiagen) and SYBR green (ThermoFisher) ...
-
bioRxiv - Genetics 2024Quote: ... and the following miRCURY LNA miRNA PCR primer sets (Qiagen, Hilden, Germany): dme-miR-210-3p (YP02104327) ...
-
bioRxiv - Immunology 2023Quote: ... The 18S reference gene was amplified using QuantiTect Primer Assay Kit (Qiagen). The primers were purchased from Integrated DNA Technologies (Coralville ...
-
bioRxiv - Molecular Biology 2023Quote: ... and V7V9 regions (primer sequences may be available upon request from Qiagen). Sequencing was performed on an Illumina MiSeq using 250|8|8|250 cycles ...
-
bioRxiv - Microbiology 2023Quote: ... QuantiTect Primer assays [ACTB (QT00095431) and CDKN1A (QT00062090)] we purchased from Qiagen. ACTB was used for normalization ...
-
bioRxiv - Bioengineering 2023Quote: ... and primers from miRCURY LNA miRNA PCR Assays (Catalog No. 339306, Qiagen) for hsa-miR-21-5p (GeneGlobe ID YP00204230) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The primers were designed using the PyroMark Assay Design Software 2.0 (Qiagen) (Supplementary Table S6) ...
-
bioRxiv - Cancer Biology 2022Quote: ... The LPAR1 and LPAR3 Quantitec primers were purchased from Qiagen (#QT00264320, #QT00107709).
-
bioRxiv - Cell Biology 2023Quote: ... and Mm_miR-29c were the miScript primer assays pre-designed by Qiagen. The mature microRNA sequences were 5’UAGCACCAUCUGAAAUCGGUUA for Mm_miR-29a ...
-
bioRxiv - Cell Biology 2021Quote: ... human myosin-18A (synthesized by Qiagen)
-
bioRxiv - Neuroscience 2023Quote: ... HEK-beta cells were transiently transfected with WT or variant NaV1.2 (2 µg) using Qiagen SuperFect reagent (Qiagen, Valencia, CA, U.S.A.).
-
bioRxiv - Neuroscience 2023Quote: ... cells were lysed using RLT buffer mastermix (10 uL beta-mercaptoethanol : 1 mL RLT) and cells were lysed with RNAeasy micro kit (Qiagen, 74004). RNA quality and quantity was validated using a nanodrop (ThermoFisher Scientific) ...
-
bioRxiv - Molecular Biology 2024Quote: ... after which all the cells were simultaneously harvested and collected in RNA lysis buffer (RLT + beta-mercaptoethanol) (Qiagen, Venlo, The Netherlands).
-
bioRxiv - Immunology 2021Quote: ... Cells for qPCR were lyzed in RNeasy lysis buffer (Qiagen 79254) containing 1% β-Mercaptoethanol and incubated for 10 minutes at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... qPCR runs were performed using a Rotorgene 6000 cycler (Qiagen, USA). Each reaction (20 μL ...
-
bioRxiv - Genomics 2020Quote: ... RT-qPCR was performed using SYBR green master mix (Qiagen # 204054) and a StepOne Plus Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Genomics 2020Quote: ... RT-qPCR was performed using SYBR green master mix (Qiagen # 204054) and a StepOne Plus Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... qPCR was carried out on a Rotor Gene Q machine (Qiagen) using 2x qQuantiNova SYBR ...