Labshake search
Citations for Qiagen :
151 - 200 of 10000+ citations for Human Nuclear Factor Of Activated T Cells 5 NFAT5 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... Sorted T cells were lysed in Buffer RLT Plus (Qiagen, Hilden, Germany) with 1% β-mercaptoethanol (Millipore-Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... Cell-free cfDNA (both human and mouse) was isolated with QIAamp DSP Circulation NA Kit (QIAGEN, Hilden, Germany) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: Total RNA was extracted from cells or human or mouse brain tissues using RNeasy Mini kit (Qiagen, 74106). Reverse transcription was carried out using iScript Reverse Transcription Supermix (Bio-Rad ...
-
bioRxiv - Cancer Biology 2024Quote: ... Human myeloma cell lines were authenticated by subjecting genomic DNA isolated with the QIAamp DNA Mini Kit (Qiagen), and short tandem repeat (STR ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was extracted from human glioblastoma cells using the RNeasy kit according to the manufacturer’s instructions (Qiagen). RNA quality was assessed on a Bioanalyzer (Agilent ...
-
bioRxiv - Genomics 2024Quote: Genomic DNA from human CD34+ cells from three normal adult donors was isolated using Gentra Puregene Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: RNA from human cell cultures was extracted from 6 well plates using RNeasy Plus micro kit (Qiagen, 74034). The plates were washed once with PBS ...
-
bioRxiv - Biochemistry 2024Quote: Total RNA was isolated from bacterial cells using the RNeasy mini kit (5 mL culture) and RNeasy maxi kit (50 mL culture) (Qiagen). RNA concentrations were measured using a Nanodrop spectrometer (ThermoScientific) ...
-
bioRxiv - Immunology 2022Quote: ... both resting and activated in vitro (as described above) and their secreted small EVs were extracted using the miRNeasy Mini Kit (QIAGEN).
-
bioRxiv - Cell Biology 2021Quote: ... Total RNA was extracted from activated gametocytes and schizonts of WT-GFP and PP1PTD parasites (two biological replicates each) using an RNeasy purification kit (Qiagen). RNA was vacuum concentrated (SpeedVac ...
-
bioRxiv - Microbiology 2019Quote: The DNA samples for shotgun metagenome sequencing were extracted from 50 mL each of the four activated sludge samples using DNeasy PowerSoil Kit (Qiagen). Sequencing of the metagenomic DNA was performed at Macrogen Inc. ...
-
bioRxiv - Cell Biology 2024Quote: Total RNA was extracted from activated gametocytes and schizonts of WT-GFP and NEK1clag parasites (two biological replicates each) using RNeasy purification kit (Qiagen). RNA was vacuum concentrated (freeze dried ...
-
bioRxiv - Cell Biology 2020Quote: ... Human cell motility RT2 profiler PCR Array (Qiagen) for control-MPC and Givi-MPC was performed ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were harvested 48 hours later and RNA was extracted from cytoplasmic or nuclear fractions using the RNeasy Mini Kit (Qiagen) with an on-column DNase digestion ...
-
bioRxiv - Genomics 2020Quote: ... RNA was extracted from the nuclear and cytosolic fractions of the embryos in different stages as explained before using the RNeasy mini kit from QIAGEN and DNase (Sigma ...
-
bioRxiv - Plant Biology 2021Quote: ... Leaf samples of about 200 plants were pooled and nuclear DNA was extracted with a DNeasy Plant Mini Kit (QIAGEN) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: Mitochondrial and nuclear DNA was isolated from pupae 9 days after egg hatching using the DNeasy Blood & Tissue kit (Qiagen). A total of 50 ng genomic DNA was used as a template to perform qPCR using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Cell Biology 2023Quote: Total RNA was isolated from the mouse cells/tissues and human cell lines using the RNeasy® Mini Kit (Qiagen Inc., Germantown, MD). For human platelets and MEG-01 cells ...
-
bioRxiv - Microbiology 2021Quote: Full-Length Individual Provirus Sequencing was performed on DNA extracted from total CD4 T cells with the DNeasy Blood & Tissue Kit (Qiagen, Cat. No. 69504), as described28 ...
-
bioRxiv - Immunology 2021Quote: ... CFSEhi and CFSElo Cas9-CD45.1 Marilyn CD4+ T cells were sorted and their gDNA extracted using 10μl of lysis buffer-AL (Qiagen-DNeasy blood and tissue kit), 1μl proteinase K (Qiagen) ...
-
bioRxiv - Microbiology 2021Quote: ... a volume equivalent to 5×108 cells were spun down (assuming 1 OD600=8×108 cells) and Protect Bacteria RNA Mini Kit (Qiagen) was used to extract total RNA as described in (Bhattacharyya et al. ...
-
bioRxiv - Immunology 2022Quote: Clonal naïve GMP and neutrophil total RNA was extracted from cells at 5×106 cells/ml using the Qiagen RNeasy Plus Mini Kit (Qiagen) with DNaseI treatment (RNase free DNase Set ...
-
bioRxiv - Microbiology 2021Quote: Total RNA (5×106 cells) was extracted from FEA or CRFK cell lines by using the RNeasy Plus Mini Kit (Qiagen). RNA from FEA ...
-
bioRxiv - Cancer Biology 2022Quote: RNA was isolated from 5 million cells per cell line using the Qiagen AllPrep DNA/RNA extraction kits (Qiagen, 80004). Nucleic acid quantification and quality detection were performed and RNA sequencing libraries were generated via Illumina Stranded mRNA prep ...
-
bioRxiv - Genetics 2023Quote: ... Genomic DNA Extraction and Purification: Genomic DNA was extracted from 5 M cells using the Gentra Puregene Cell Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: Total RNA was prepared from 5×106-1×107 cells using the RNeasy MIDI Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: We extracted RNA from 5 × 105 cells using the QIAGEN RNeasy Mini kit (Qiagen, cat # 74014) with DNase I treatment (Qiagen ...
-
bioRxiv - Microbiology 2024Quote: ... DNA was prepared from approximately 5×106 cells using the DNeasy-96 kit (Qiagen, Hilden, Germany), according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... we differentiated human stem cells for 3 days in mTeSR + 0.5 µM A8301 and extracted RNA with RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... and human BON1 cell line [8] were isolated with RNeasy Plus Universal Kits (Qiagen Cat no. 73404, Germantown, MD) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... then nuclear lysates were stored in Buffer RLT (Qiagen 79216) at -80C ...
-
bioRxiv - Immunology 2023Quote: ... RNA from human PBMCs was isolated using RNeasy Kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2022Quote: ... nuclear DNA was isolated from the sorted myonuclear and non-myonuclear fractions using QIAmp DNA Micro Kit (Qiagen, Germantown, MD, USA) with adjusted reagents’ volumes to the samples size ...
-
bioRxiv - Molecular Biology 2024Quote: ... Two more washes with Nuclear RNA wash buffer were performed before proceeding to RNA extraction using the Rneasy Plus Micro Kit (Qiagen, #74034) with the addition of an on-column DNAse digestion (Qiagen ...
-
bioRxiv - Cancer Biology 2019Quote: ... was isolated from human PanNET specimens or cells grown on 6-cm or 10-cm plates using RNeasy mini kit (Qiagen) containing gDNA eliminator spin columns ...
-
bioRxiv - Plant Biology 2019Quote: ... three replicates of 25 to 30 pooled egg cells were used for total RNA extraction according to the “Purification of total RNA from animal and human cells” protocol of the RNeasy Plus Micro Kit (Qiagen). In brief ...
-
bioRxiv - Immunology 2020Quote: ... Total RNA was extracted from the sorted cells according to the “Purification of total RNA from animal and human cells” protocol of the RNeasy Plus Micro Kit (QIAGEN). After pelleting by centrifugation for 5 minutes at 5,000 x g ...
-
bioRxiv - Bioengineering 2022Quote: qRT-PCR of SARS-Cov-2 RNA was performed as previously described.59 RNA was extracted from human lung epithelial cells expressing human ACE2 (A549-hACE2) grown in 96-well plates by using the RNeasy 96 Kit (Qiagen) per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: Total RNAs were extracted from human benign prostatic cells using RNeasy Mini Kit as per manufacture’s protocol (Qiagen, Cat # 74104). cDNA was synthesized using 2µg of RNA using a high-capacity RNA to cDNA kit (applied biosystems ...
-
bioRxiv - Physiology 2023Quote: Cytokines secreted from nonapoptotic and apoptotic NCTC cells were screened with the Human Inflammatory Cytokines Multi-Analyte ELISArray Kit (QIAGEN). Nonapoptotic and apoptotic NCTC cell supernatants were prepared in replicate serial dilutions of the Antigen Standard ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA was extracted from sorted cells and from two replicated of in vitro cultured E-A14 cells stabilized in RLT buffer according to the “Purification of total RNA from animal and human cells” protocol of the RNeasy Micro Kit (Qiagen). The SMARTer Ultra Low Input RNA Kit for Sequencing v4 (Clontech Laboratories ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA from the human cell lines and mouse tumor samples was extracted using RNeasy Plus Mini Kits (Qiagen, 74134) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... Genomic DNA (gDNA) was extracted from 1-5×106 cells using DNeasy Blood and Tissue Kit (Qiagen) and 250 ng gDNA ...
-
bioRxiv - Synthetic Biology 2021Quote: mESC gDNA was purified from 1-5 million cells using the QIAamp DNA mini kit (Qiagen 51306) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2024Quote: RNA was extracted from 2-5 million flash frozen cells using the RNeasy plus mini kit (Qiagen). Libraries were prepared using the NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina (New Englands Biolabs) ...
-
bioRxiv - Immunology 2023Quote: ... cells pooled from n = 3 - 5 mice / cohort) was isolated using the RNeasy Plus Mini Kit (Qiagen). Clariom S microarray analysis (Affymetrix ...
-
bioRxiv - Cell Biology 2023Quote: ... Sorted cells were then centrifuged (300xg, 5 min) before RNA isolation using the RNeasy Mini Kit (Qiagen), according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Biochemistry 2023Quote: ... gDNA was isolated from 5 x 106 Colo205 cells using the Blood and Cell Culture DNA Maxi Kit (Qiagen, catalog no. 13362) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... astrocytes and human brain tissue using the RNeasy Mini kit (Qiagen) and reverse transcribed using the High-Capacity RNA-to-cDNA kit (ThermoFisher Scientific) ...