Labshake search
Citations for Qiagen :
1851 - 1900 of 2037 citations for L β Homo β 2 hydroxyphenyl glycine; R 3 Amino 3 2 hydroxyphenyl propanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Genomic high-molecular-weight DNA was extracted from cell pellets using MagAttract R HMW DNA Kit (Qiagen, Hilden, Germany) to a final elution volume of 100 μL ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was isolated from collected BmCPV-infected midguts with RNeasy R Plus Mini Kits (Qiagen, Valencia, CA, USA). After genomic DNA was digested by RNase-free DNase (Qiagen ...
-
bioRxiv - Pathology 2021Quote: ... Ion Torrent-specific sequencing libraries were generated using the GeneRead L Core Kit (Qiagen, Hilden, Germany) together with IonXpress barcode adaptors (Thermo Fisher Scientific) ...
-
bioRxiv - Biophysics 2020Quote: ... proteins were expressed in Escherichia coli strain BL21 (DE3) and purified via nickel-nitrilotriacetic acid affinity chromatography (Qiagen) followed by ion exchange chromatography on an Äkta system (GE Healthcare) ...
-
bioRxiv - Genomics 2020Quote: Nucleic acids were isolated from 4 mL of plasma by using a QIAamp cfDNA/RNA kit (Qiagen 55184) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... Total nucleic acids were extracted using QIAamp 96 virus Qiacube HT kit on QIAxtractor Automated extraction (Qiagen, US) following the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2021Quote: ... Nucleic acids were isolated via chloroform extraction and RNA was isolated with the Qiagen RNEasy Mini (Qiagen #74104) including on-column DNase I digestion ...
-
bioRxiv - Plant Biology 2020Quote: ... Magnetic beads (Dynabeads M-270 Carboxylic Acid) were activated and coated with ad hoc designed LNA probes (Qiagen), harboring an −NH2 group ...
-
bioRxiv - Microbiology 2020Quote: ... Total nucleic acid was extracted from 140 ul of sample fluid using the QIAamp RNA Viral kit (Qiagen) and eluted with 30 ul of DEPC-treated water ...
-
bioRxiv - Microbiology 2020Quote: ... The 6 × his-tagged proteins were purified using a nickel-nitrilotriacetic acid (Ni-NTA) agarose matrix (30250, Qiagen). Cell-free extracts were loaded on 0.5 ml Ni-NTA matrixes and incubated on a roller shaker for 2 h at 4 °C ...
-
bioRxiv - Microbiology 2020Quote: Nucleic acids were extracted from mouse fecal samples and inoculum samples using the DNeasy Powersoil HTP Kit (QIAGEN) and from the further simplified SC2 samples using the Powermag Microbiome kit (MoBio) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 0.5% deoxycholic acid with a protease inhibitor) and pre-cooled tissue homogenizer (TissueLyser LT, Qiagen GmbH, Hilden, Germany) for 2-4 min at 45 Hz ...
-
bioRxiv - Cell Biology 2021Quote: RNA was extracted from up to 500 μl of plasma using QIA amp Circulating Nucleic Acid Kit (Qiagen) and eluted in 15 μl volume ...
-
bioRxiv - Microbiology 2023Quote: Total nucleic acids were extracted from half of each sample’s O.2μm filter using DNAeasy PowerSoil Kit (Qiagen). Extraction blanks were run with each round of DNA extractions and all returned no detectable nucleic acids using the maximum amount of blank sample (20μL ...
-
bioRxiv - Neuroscience 2023Quote: ... Deoayribonucleic acid (DNA) was extracted from stored buffy coat using the Blood Mini DNA kit (Qiagen, Valencia, CA). A TaqMan® single nucleotide polymorphism (SNP ...
-
bioRxiv - Microbiology 2023Quote: ... Viral nucleic acids were extracted using the QIAMP® Viral RNA mini kit (60 µL, Qiagen, Venlo, Netherlands) without the addition of carrier RNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 700 μl of the supernatant was mixed with 30 μl of nickelnitrilotriacetic acid-agarose (Ni-NTA, Qiagen) for 2 h at RT with mild rotation ...
-
bioRxiv - Cell Biology 2022Quote: ... and the soluble fraction of the lysate was incubated with Ni2+-nitrilotriacetic acid (NTA) beads (Qiagen, Hilden, Germany). Proteins were eluted with 300 mM imidazole in 60 mM NaH2PO4 ...
-
bioRxiv - Biophysics 2023Quote: ... The supernatant was filtered through a 0.45 μm filter and loaded on a nickel-nitrilotriacetic acid column (Qiagen) pre-equilibrated with lysis buffer ...
-
bioRxiv - Biochemistry 2022Quote: ... Lysates of His-tagged talin constructs were purified by Ni-NTA-sepharose affinity chromatography (Ni2+-nitrilotriacetic acid, Qiagen), followed by a gel filtration column (Superdex 200 ...
-
bioRxiv - Biochemistry 2022Quote: ... Lysates of His-tagged vinculin constructs were purified by Ni-NTA-sepharose affinity chromatography (Ni2+-nitrilotriacetic acid, Qiagen), followed by a Q-Sepharose ion exchange column ...
-
bioRxiv - Genetics 2024Quote: ... The first PCR amplified from HTT to GFP (F: ATGAAGGCCTTCGAGTCCCTCAAGTCCTTC, R: GTCCAGCTCGACCAGGATG) Taq PCR Core Kit with Q solution (Qiagen) with 5 µL of the genomic DNA with initial denaturation 95°C (5 min) ...
-
bioRxiv - Microbiology 2024Quote: ... ACCTGGTTGATCCTGCCAGGTAGC and R: AGC CAT TCG CAG TTT TGT AC prior to purification using a QIAquick gel extraction kit (Qiagen). ISG15 gene expression was quantified using a SYBR Green-based real-time RT-PCR kit (Qiagen) ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA was isolated from aged and aged Nox4-/+ L-MSCs using RNeasy® Mini Kit (Qiagen) and reverse transcribed using iScript Reverse Transcription SuperMix for RT-qPCR (Bio-Rad) ...
-
bioRxiv - Microbiology 2021Quote: ... The enriched and purified samples were amplified using the GeneRead DNA Library L amplification Kit (Qiagen, Germany) according to manufacturer’s instructions with 14 cycles and amplicons were purified using solid-phase paramagnetic bead technology ...
-
bioRxiv - Genomics 2023Quote: ... 2μL DNA was amplified in a 30μL reaction consisting of 14.33μL QuantiTect Multiplex PCR NoROX mix (Qiagen), 0.67μL QuantiTect Multiplex PCR mix with ROX (Qiagen) ...
-
bioRxiv - Biochemistry 2022Quote: ... the lysate was supplemented with Ni-NTA agarose (Qiagen, 1.3 ml resin/ 1 l insect cell pellet). Subsequently ...
-
bioRxiv - Neuroscience 2021Quote: ... Hybridization was performed with a double DIG-labeled locked nucleic acid (LNA) probe for Nato3 (/5DiGN/ACTCAGCGTCTATCTCACCGA/3DiG_N/) (Qiagen) and incubated overnight at 62 °C ...
-
bioRxiv - Microbiology 2020Quote: ... followed by extraction of viral nucleic acids using a commercial kit (QIAamp MinElute virus spin kit, Qiagen, Venlo, Netherlands). A portion (2.5 µl ...
-
bioRxiv - Neuroscience 2020Quote: ESR1 expression was manipulated with custom-designed locked nucleic acid (LNA™) 15-mer antisense oligonucleotides designed by Qiagen following Kelly & Goodson.41 The antisense oligo for ESR1 knockdown (ESR1-KD ...
-
bioRxiv - Plant Biology 2020Quote: ... 200 mg of freeze-dried and ground roots were mixed with 1.6 mL of 1 M perchloric acid and homogenized in a TissueLyser II (Qiagen) in microtubes containing 6 glass beads of 2.8 mm in diameter ...
-
bioRxiv - Microbiology 2020Quote: ... Extraction of viral nucleic acids from clinical sample was performed with a QIAamp Viral RNA Mini Kit (Qiagen #52906) as described by manufacturer ...
-
bioRxiv - Immunology 2022Quote: ... Nucleic acid was first extracted from each blood sample using QIAamp MinElute Virus Spin kits (Qiagen, Mississauga, Ontario, Canada) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Headless HA stalk proteins were expressed in 293F cells and purified using nickel-nitrilotriacetic acid agarose (no. 1018244, Qiagen) in 5-ml polypropylene columns (no ...
-
bioRxiv - Microbiology 2022Quote: ... followed by total nucleic acid extraction of 400 ul of pretreated stool using the EZ1 Virus Mini Kit v2.0 (Qiagen). Extracts were eluted in 60 ul volume.
-
bioRxiv - Microbiology 2022Quote: ... N-terminal His-tagged SlPR1 and SlChi3 proteins were purified using Ni-nitrilotriacetic acid (Ni-NTA) affinity resin (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... The supernatant was collected and was mixed with a small volume of preequilibrated Ni-nitrilotriacetic acid (NTA) beads (Qiagen) for 2 h on a rocking platform at 4°C ...
-
bioRxiv - Microbiology 2020Quote: ... and 8 M urea [pH 8.0]) and His-tagged Tax proteins were precipitated with Ni-nitrilotriacetic acid (NTA) agarose (Qiagen). After washing in buffer C (100 mM NaH2PO4 ...
-
bioRxiv - Neuroscience 2020Quote: ... PrP was expressed in Rosetta2(DE3)pLysS E.coli competent cells and purified by affinity chromatography using Ni2+-nitrilotriacetic acid Superflow resin (QIAGEN). In the RT-QuIC assay ...
-
bioRxiv - Neuroscience 2020Quote: ... was expressed in Rosetta2(DE3)pLysS E.coli competent cells and purified from inclusion bodies by affinity chromatography using Ni2+-nitrilotriacetic acid Superflow resin (QIAGEN). Recombinant hamster PrP (HaPrP ...
-
bioRxiv - Biochemistry 2021Quote: ... The ankyrin repeat domains were purified over a Ni-nitrilotriacetic acid column (2.5 ml column volume) according to the manufacturer’s instructions (QIAgen, Germany). Up to 200 mg of highly soluble ankyrin repeat domains were purified from one liter of E ...
-
bioRxiv - Microbiology 2021Quote: ... nucleic acids from each sample were extracted using QIAamp 96 DNA kit and Qiacube HT robot (both from Qiagen). Viral RNA yields were measured using a RT-qPCR assay targeting the rdrp gene as previously described[13].
-
bioRxiv - Cell Biology 2021Quote: ... Lysates were equalized and His6-HA-SUMO1-conjugates were enriched on nickel-nitrilotriacetic acid (NiNTA) agarose beads (Qiagen, #L30210) as described in15 ...
-
bioRxiv - Microbiology 2023Quote: ... Extractions of viral nucleic acids from 140 µl samples were performed with the QIAamp Viral RNA Mini Kit (Qiagen), according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... Samples were moved on magnet and supernatant was transferred to clean 1.5 mL tubes for nucleic acid extraction using the MinElute PCR Purification Kit (Qiagen). Purified DNA was used for library preparation using the NEBNext Ultra Library prep Kit (Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: ... The kidneys were homogenized using 0.5 M acetic acid and two 5-mm steel beads in TissueLyser LT (Qiagen), followed by addition of pepsin to 0.1 mg/ml and incubation for 3 days ...
-
bioRxiv - Microbiology 2023Quote: We extracted nucleic acids from each 200 μL aliquot using the AllPrep PowerViral DNA/RNA kit (Qiagen, Hilden, Germany) using Glass PowerBead tubes included with the kit ...
-
bioRxiv - Immunology 2022Quote: ... The supernatant was harvested at day 4 after transfection and incubated with Ni-nitrilotriacetic acid (Ni-NTA) agarose (Qiagen). The purification was carried out using gravity flow column and eluted with imidazole-containing buffer as previously described57,58 ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA was extracted using hot acid-phenol (Uppuluri et al., 2007) and cleaned up using the RNeasy kit (Qiagen). Libraries were prepared using the NuGEN Universal Plus mRNA kit ...
-
bioRxiv - Neuroscience 2024Quote: ... Hybridization was performed at 66 °C overnight with 40 nM 5′ TYE-563-labelled locked nucleic acid (LNA)-(C4G2)2.5 probe (Exiqon Qiagen). Cells were then washed once in 2X SSC/0.1% Tween-20 for 5 minutes and three times in 0.1X SSC for 10 minutes at RT before being dehydrated as above and nuclei stained with DAPI.