Labshake search
Citations for Qiagen :
1501 - 1550 of 6183 citations for ssc mir 15a RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2020Quote: ... with Omniscript RT Kit used to obtain cDNA for qPCR (QIAGEN).
-
bioRxiv - Cancer Biology 2022Quote: ... The reagents for RT-qPCR include the RNeasy Mini Kit (Qiagen), Power SYBR Green PCR Master Mix and High-Capacity cDNA Reverse Transcription Kits (Applied Biosystems) ...
-
bioRxiv - Biochemistry 2020Quote: ... and bead-bashed for 5 min at RT (Qiagen TissueLyser II). Lipid extracts were prepared using a modified version of the Bligh and Dyer lipid extraction [70] ...
-
bioRxiv - Bioengineering 2021Quote: ... and complimentary DNA (cDNA) was synthesized with Omniscript RT kit (Qiagen). RT-qPCR was performed on the QuantStudio™ 7 Flex (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2022Quote: ... RT-qPCR was carried out using the SYBR Green I (Qiagen) mix with primers targeted to U2 and U6 snRNA (Supplementary file 2) ...
-
bioRxiv - Molecular Biology 2019Quote: ... The cDNA was created using the miScript II RT kit (QIAGEN). Specifically ...
-
bioRxiv - Cancer Biology 2019Quote: ... Reverse transcription was performed using the miScript II RT Kit (Qiagen) and qPCR was performed using the SyBr Green PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2021Quote: ... The cDNA was synthesized using the miRCURY LNA RT Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... and reverse transcribed using the miScript II RT Kit (Qiagen, 218161). Quantitative realtime PCR was performed using StepOnePlus real-time PCR instrument ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA were reverse transcribed using the miRCURY LNA RT kit (Qiagen) and qPCR was performed using custom primers (Table S2 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The reagents for RT-qPCR include the RNeasy Mini Kit (Qiagen), Power SYBR Green PCR Master Mix and High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA synthesis was carried out using a Sensiscript RT kit (Qiagen). RNA was transcribed into cDNA using an oligo dTn primer (Promega ...
-
bioRxiv - Microbiology 2022Quote: ... total RNA was reverse transcribed using the Omniscript RT kit (Qiagen), and the resulting DNA was amplified with the HotStarTaq DNA Polymerase (Qiagen ...
-
bioRxiv - Molecular Biology 2022Quote: DNA samples were analyzed by RT-qPCR using QuantiTect SYBR (Qiagen) on a Light Cycler II 480 (Roche) ...
-
bioRxiv - Genetics 2022Quote: ... RT-qPCR was performed using SYBR green master mix (Qiagen # 204054) and a StepOne Plus Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Immunology 2022Quote: ... cDNA was then reverse-transcribed using the QIAGEN RT kit (QIAGEN) according to the manufacturer’s instructions and subjected to RT-PCR using the QIAGEN QuantiTect SYBR Green PCR Master Mix in triplicate ...
-
bioRxiv - Molecular Biology 2022Quote: ... RT-qPCR was carried out using the SYBR Green I (Qiagen) mix with primers targeted to U2 and U6 snRNA (Supplementary file 2) ...
-
bioRxiv - Immunology 2022Quote: ... RT-qPCR was conducted in a Rotor-Gene Q system (Qiagen) for over 40 cycles with an annealing temperature of 60 °C ...
-
bioRxiv - Microbiology 2023Quote: ... followed by cDNA conversion using the Omniscript RT kit (Qiagen, Germany) according to kit instructions ...
-
bioRxiv - Neuroscience 2023Quote: Extracted mRNA samples were reverse transcribed (Qiagen Omniscript RT kit, Qiagen) and stored at −20°C ...
-
bioRxiv - Neuroscience 2023Quote: Extracted mRNA samples were reverse transcribed (Qiagen Omniscript RT kit, Qiagen) and stored at −20°C ...
-
bioRxiv - Physiology 2023Quote: ... Total RNA was reverse transcribed using the QuantiTect RT Kit (QIAGEN) and real-time polymerase chain reaction (PCR ...
-
bioRxiv - Neuroscience 2023Quote: ... extracted mRNA samples were reverse transcribed (Qiagen Omniscript RT kit, Qiagen) and stored at −20°C ...
-
bioRxiv - Neuroscience 2023Quote: ... extracted mRNA samples were reverse transcribed (Qiagen Omniscript RT kit, Qiagen) and stored at −20°C ...
-
bioRxiv - Immunology 2023Quote: ... RT qPCR was conducted with custom array plates (330171, Qiagen, Canada) using the LightCycler 480 Real-Time PCR system (Roche Molecular Systems Inc. ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA synthesis was performed using the RT² First Strand Kit (Qiagen). The RT² Profiler™ PCR Array Mouse Common Cytokine (Qiagen ...
-
bioRxiv - Immunology 2019Quote: ... and normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH; all primers from Qiagen).
-
bioRxiv - Molecular Biology 2019Quote: ... followed by fragmentation and reverse transcription with random primers (Qiagen, Hilden, Germany). Second-strand cDNAs were synthesized using RNase H and DNA polymerase I ...
-
bioRxiv - Genomics 2020Quote: ... 5 pM of each primer and 2.0 U HotStar Taq polymerase (Qiagen) in a 25 µl volume or 1X Phusion U Hotstart (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA was synthesized using random primers and QuantiTect Reverse Transcription kit (Qiagen). Quantitative PCR (qPCR ...
-
bioRxiv - Neuroscience 2020Quote: ... with 1 µL cDNA using the following oligonucleotides (QuantiTect Primer Assays, Qiagen): Gli1 (Gli1 ...
-
bioRxiv - Genomics 2020Quote: ... Jun was amplified using pre-designed primers from Qiagen (cat no. QT00296541).
-
bioRxiv - Microbiology 2020Quote: ... ICAM and P-Selectin were from the QuantiTect primer assay kit (Qiagen). Results are expressed following normalization using 18S RNA.
-
bioRxiv - Immunology 2022Quote: ... These primers were designed using the PyroMark Assay Design 2.0 software (Qiagen). PCR amplicons were pyrosequenced using the PyroMark Q48 system and analyzed with PyroMark Q48 Autoprep software.
-
bioRxiv - Neuroscience 2020Quote: ... and 2.5 μL of nuclease-free water containing predesigned primers (#249900, Qiagen; QuantiTect Primer Assays IL-6 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Pyrosequencing primers were designed using the PyroMark Assay Design Software 2.0 (Qiagen). 500ng of genomic DNA was subjected to bisulfite conversion using the EpiTect Bisulfite Kit (Qiagen ...
-
bioRxiv - Neuroscience 2020Quote: ... HIF-1α (#QT01039542) and VEGF (#QT00160769) were analyzed using primers from Qiagen. Primers for all other genes investigated are listed in the table below:
-
bioRxiv - Immunology 2021Quote: ... These primers were designed using the PyroMark Assay Design 2.0 software (Qiagen). PCR amplicons were pyrosequenced using the PyroMark Q48 system and analyzed with PyroMark Q48 Autoprep software.
-
bioRxiv - Immunology 2024Quote: ... STAT2 and 18s rRNA were measured using validated gene-specific primers (QIAGEN). Primers for ACAT1 ...
-
bioRxiv - Cancer Biology 2024Quote: ... For two-way qPCR (analysis of MAPK11; Hs_MAPK11_1_SG QuantiTect Primer Assay, Qiagen); cDNA was first synthesised with High Capacity cDNA Reverse Transcription Kit (Fisher) ...
-
bioRxiv - Cancer Biology 2024Quote: ... For one-way qPCR (analysis of MAP3K1, Hs_MAP3K1_1_SG QuantiTect Primer Assay, Qiagen); Luna® Universal One-Step RT-qPCR Kit was used ...
-
bioRxiv - Neuroscience 2023Quote: ... Primers for human ZMPSTE24 Hs_ZMPSTE24_1_SG QuantiTect) were predesigned and validated by QIAGEN and used diluted to a final work solution of 1x (QuantiTect Primers ...
-
bioRxiv - Immunology 2023Quote: ... The 18S reference gene was amplified using QuantiTect Primer Assay Kit (Qiagen). The primers were purchased from Integrated DNA Technologies (Coralville ...
-
bioRxiv - Molecular Biology 2023Quote: ... and V7V9 regions (primer sequences may be available upon request from Qiagen). Sequencing was performed on an Illumina MiSeq using 250|8|8|250 cycles ...
-
bioRxiv - Microbiology 2023Quote: ... QuantiTect Primer assays [ACTB (QT00095431) and CDKN1A (QT00062090)] we purchased from Qiagen. ACTB was used for normalization ...
-
bioRxiv - Cancer Biology 2023Quote: ... The primers were designed using the PyroMark Assay Design Software 2.0 (Qiagen) (Supplementary Table S6) ...
-
bioRxiv - Cancer Biology 2022Quote: ... The LPAR1 and LPAR3 Quantitec primers were purchased from Qiagen (#QT00264320, #QT00107709).
-
bioRxiv - Cell Biology 2023Quote: ... and Mm_miR-29c were the miScript primer assays pre-designed by Qiagen. The mature microRNA sequences were 5’UAGCACCAUCUGAAAUCGGUUA for Mm_miR-29a ...
-
bioRxiv - Genomics 2019Quote: Two step PCR Each PCR reaction included 25.0 μl of 2X buffer (MultiPlex PCR Master Mix, Qiagen). One microliter each of the 10 pmol forward and reverse primers (Select MultiGEN Diagnostics ...
-
Assessment of salivary microRNA by RT-qPCR: Challenges in data interpretation for clinical diagnosisbioRxiv - Molecular Biology 2024Quote: Q-PCR reactions using miRCURY LNA SYBR Green PCR Kit and miRCURY LNA miRNA PCR Assay (Qiagen) were prepared in 384 multi-well plates ...