Labshake search
Citations for Qiagen :
1401 - 1450 of 6183 citations for ssc mir 15a RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... total RNA was extracted using the RNeasy Mini Kit and RNase-Free DNase Set (Qiagen). cDNA synthesis was conducted using the SuperScript IV First-Strand Synthesis System (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2019Quote: ... with an additional on-column DNA digestion using the RNase-Free DNase Set (Qiagen; 79254). RNA was depleted of rRNA and RNA-seq libraries prepared as for the 4sU-seq.
-
bioRxiv - Genomics 2019Quote: ... On-column DNase I digestions were performed with the Qiagen RNase-free DNase Set (Qiagen). RNA was eluted with 200 μL RNAse-free water (Qiagen ...
-
bioRxiv - Cell Biology 2019Quote: ... with an additional on-column DNA digestion using the RNase-Free DNase Set (Qiagen; 79254). cDNA was synthesised from 1 μg RNA using SuperScript II Reverse Transcriptase (ThermoFisher Scientific ...
-
bioRxiv - Genomics 2019Quote: ... An on-column DNase I digestion was carried out using RNase-free DNase set (QIAGEN). RNA was eluted in 30 μL of RNase-free water ...
-
bioRxiv - Genomics 2019Quote: ... 9.5 mL Qiagen Buffer G2 from the Genomic DNA Buffer Set (Cat. No. 19060, Qiagen), 19 μL RNase A (100mg/mL ...
-
bioRxiv - Physiology 2019Quote: ... TF set was constructed by combining genes in Ingenuity Pathway Analysis (IPA, Qiagen, www.qiagen.com/ingenuity) categories “transcription regulator” and “ligand-dependent nuclear receptor” ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... followed by an intermediate on-column DNase treatment using the RNase-Free DNase Set (Qiagen) to remove any residual DNA prior to RNA purification ...
-
bioRxiv - Systems Biology 2021Quote: ... On-column DNase treatment was performed with a RNase-free DNase set (Qiagen, Valenica, CA). The 200-ul PicoPure extraction buffer containing gut RNA was applied onto two PicoPure spin columns and the final eluted RNA samples were combined for maximizing the RNA yield ...
-
bioRxiv - Immunology 2020Quote: ... DNA was eliminated using DNase digestion/ treatment using RNase-Free DNase Set (Qiagen, Hilden, Germany) by adding it directly onto the columns ...
-
bioRxiv - Cell Biology 2021Quote: ... including the on-column DNase digestion step with the RNase-Free DNase Set (Qiagen Inc.). One µg RNA was reverse transcribed using the MLV RT kit (Promega) ...
-
bioRxiv - Microbiology 2022Quote: ... DNase treatment was carried out in solution using the RNase-free DNase Set (Qiagen #79254) and purified with the RNeasy MinElute spin columns (Qiagen #74204 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Samples were treated on column with DNase using RNase-Free DNase Set (Qiagen, Hilden Germany). Libraries were prepared according to the Illumina TruSeq RNA protocol and sequenced on an Illumina HiSeq2500 machine (Illumina ...
-
bioRxiv - Pathology 2022Quote: ... Total RNA was isolated using a RNeasy Mini Kit and DNase Digestion set (217004, Qiagen) according to the manufacture’s protocol ...
-
bioRxiv - Physiology 2023Quote: ... The optional DNAse step was always performed using the RNase-Free DNase Set kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... and on-column DNase I treatment was performed using the RNase-Free DNase set (Qiagen). Tumor mRNA samples were submitted to the Montreal Clinical Research Institute (IRCM ...
-
bioRxiv - Neuroscience 2024Quote: Total RNA was extracted using the RNeasy Mini Kit with RNase-free DNase set (Qiagen). Reverse transcription was performed using the SuperScript VILO cDNA Synthesis Kit (Thermo Fisher ...
-
bioRxiv - Microbiology 2024Quote: ... Bacterial RNA extractions were done using the RNAse-Free DNase Set (Cat. no. 79254, Qiagen) as per the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... following manufacturer’s instructions for on-column DNase treatment using RNase-Free DNase Set (QIAGEN, #79254) and the addition of a second wash with Buffer RPE ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA contamination was removed from purified RNA by using the RNase-Free DNase set (Qiagen). RNA concentration was determined by measuring the absorbance at 260 nm ...
-
bioRxiv - Microbiology 2023Quote: ... and genomic DNA was digested on column by using the RNase-Free DNase Set (Qiagen). RNA quality was assessed using a 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Neuroscience 2023Quote: mRNA was isolated using the RNeasy Mini Kit and RNase-Free DNase set (Qiagen, 74136), and template cDNA was prepared by reverse transcription using the PowerUp SYBR Green master mix for qRT-PCR (Life Technologies ...
-
bioRxiv - Developmental Biology 2023Quote: ... using a standard procedure with DNase on column digestion (RNase-free DNase set. #79254, QIAGEN). RNA was eluted in RNase DNase-free water provided by the RNeasy Mini Kit ...
-
bioRxiv - Immunology 2023Quote: Gene set analysis was performed using Ingenuity Pathway Analysis (IPA; Winter 2019 Release, QIAGEN Inc.) and Gene Set Enrichment Analysis (GSEA ...
-
bioRxiv - Neuroscience 2023Quote: ... All RNA samples were subjected to DNAse digestion using RNAse-free DNAse set (Qiagen #79256) and eluted in 35 μl ultra-pure H2O ...
-
bioRxiv - Physiology 2024Quote: ... on column DNase digest was performed with the “RNase-Free DNase Set” (Qiagen, Ref# 79254). Lyophilized DNAse was resuspended in 500 μl of H2O ...
-
bioRxiv - Microbiology 2023Quote: ... Genomic DNA digestion was completed during RNA purification using the RNase-Free DNase set (Qiagen). Reverse transcription was performed with QuantiTect Rev ...
-
bioRxiv - Immunology 2024Quote: ... samples were treated on-column with the Qiagen RNase-free DNase I set (Qiagen, 79254) according to the method described in appendix D of the Qiagen RNeasy mini kit manual (Qiagen ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA was digested on columns using the RNase-free DNase Set (Qiagen, Valencia, CA, USA). Quality control of the RNA extraction was performed using the Epoch spec for quantity and quality ...
-
bioRxiv - Genomics 2024Quote: ... implementing a DNase digestion step with the RNase-Free DNase Set (QIAGEN, Valencia, CA, USA). DNA and RNA samples were received and validated via standard quality control procedures at Novogene Co. ...
-
bioRxiv - Cancer Biology 2021Quote: ... miScript primer assays for Hs_miR-22_1 and Hs_RNU6-2_11 from Qiagen were used.
-
bioRxiv - Cell Biology 2020Quote: ... mRNA expression level was evaluated using specific QuantiTect Primer Assays (QIAGEN) specific for NUPR1 (QT00088382) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Primers (IDT) were designed using the PyroMark Assay Design software (Qiagen)
-
bioRxiv - Molecular Biology 2020Quote: ... and the appropriate bespoke designed miScript Primer Assays (Qiagen, Crawley, UK). Real-time PCR was undertaken using a LightCycler® 96 system (Roche) ...
-
bioRxiv - Genomics 2020Quote: ... or (ii) QIAseq SARS-CoV-2 Primer Panel (Qiagen GmbH, Germany) for amplified of viral genome sequencing or (iii ...
-
bioRxiv - Genomics 2021Quote: ... Housekeeping gene GAPDH primers were purchased from Qiagen (Cat. No. QT00079247) and CHI3L1 primers ...
-
bioRxiv - Cell Biology 2021Quote: ... The master mix without primers was purchased from Qiagen (Manchester, UK) and primers were synthesised from Primer Design (Southampton ...
-
bioRxiv - Cancer Biology 2024Quote: ... GAPDH was used as a control (Hs_Gapdh_3_SG QuantiTect Primer Assay, Qiagen). Each sample was tested in three technical replicates.
-
bioRxiv - Neuroscience 2023Quote: ... Primers were designed with the PyroMark Assay Design 2.0 software (Qiagen), based on the Ensembl GRCh37 assembly (See Supplementary Table 10) ...
-
bioRxiv - Genetics 2022Quote: ... miScript primers for miRNA-205 and control Sno25 were from Qiagen. Reactions were performed according to the manufacturer’s manual and on a CFX384 real-time system (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2023Quote: ... For Il7 and Egr1 QuantiTect primers (QT00101318 and QT00265846, respectively, Qiagen) were used for quantiative PCR ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was followed by PCR purification using a QIAquick PCR Purification kit and protocol (Qiagen). About 50 ng of cleaned PCR product of either DENV2 or ZIKV was separately cloned into a TOPO-TA PCR cloning vector (ThermoFisher Scientific ...
-
bioRxiv - Developmental Biology 2021Quote: ... Quantitative reverse transcription PCR (qRT-PCR) was performed using QuantiFast SYBR Green PCR Kit (Qiagen) and a DNA Engine Opticon System (GRI) ...
-
bioRxiv - Cell Biology 2020Quote: ... the PCR products were purified using PCR purification (Qiagen), followed by restriction enzyme digestion ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCRs were purified with the PCR cleanup kit (Qiagen), and subjected to next generation sequencing with sequencing primer TGATTGACTACCCGTCAGCGGGGGTCTTTCA and indexing primer TATACTTTCTAG+A+GAATAGGAACTTCGGAATA+G+GAACT (+N = LNA modification).
-
bioRxiv - Plant Biology 2020Quote: ... 2.0 μL of PCR buffer (Qiagen 10x PCR Buffer), 1.0 μL of DMSO ...
-
bioRxiv - Microbiology 2020Quote: ... PCR products were purified QIAquick PCR Purification Kit (Qiagen) and cloned into the pCRII-TOPO-TA vector (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... PCR products were purified using PCR purification kit (Qiagen) and digested with restriction enzyme KpnI-HF (New England BioLabs ...
-
bioRxiv - Microbiology 2020Quote: ... PCR product was cleaned (Qiagen MinElute PCR Purification Kit) and resuspended in water at a desired concentration of 1-2 ug/uL as measured by a Qubit 3.0 dsDNA assay (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCR samples were amplified using PyroMark PCR kit (Qiagen). PCR products were sequenced using PyroMark Q48 Advanced CpG reagents on a PyroMark Q48 Autoprep instrument (Qiagen) ...