Labshake search
Citations for Qiagen :
1501 - 1550 of 10000+ citations for Rat Wide range C Peptide CP CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... Power Biofilm DNA Isolation kits (Qiagen) were used for DNA isolation and DNA samples were stored in -80°C freezer ...
-
bioRxiv - Microbiology 2024Quote: ... The QIAseq miRNA Library Kit (Qiagen) was used to prepare cDNA libraries ...
-
bioRxiv - Molecular Biology 2024Quote: ... or FlexiGene DNA Kit (Qiagen, 51206). Unmethylated lambda DNA (Promega ...
-
bioRxiv - Cell Biology 2024Quote: RNeasy Plus mini kit (Qiagen, 74134) was employed to extract the RNA according to the manufacturer’s instructions and then quantified using a NanoDrop spectrophotometer (ThermoFisher Scientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... Quantinova Reverse Transcription Kit (Qiagen, 205413) was used according to the manufacturer’s instructions to transcribe the RNA to cDNA ...
-
bioRxiv - Cell Biology 2024Quote: RNeasy Micro Kit (Qiagen; cat. #74004) was used to extract whole cell RNA ...
-
bioRxiv - Developmental Biology 2024Quote: ... and RNeasy Mini Kit (Qiagen #74104). The purified RNAs were reverse transcribed with the iScriptTM Reverse Transcription Supermix (Bio-Rad #1708841) ...
-
bioRxiv - Neuroscience 2024Quote: ... and RNeasy Mini Kit (Qiagen, #74104) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... or the RNeasy kit (Qiagen, Germany) in accordance with the respective manufacturer’s protocols ...
-
bioRxiv - Microbiology 2024Quote: ... or QuantiTect Reverse Transcription kit (Qiagen). ZIKV RNA and vglut1 mRNA were detected by droplet digital PCR (ddPCR ...
-
bioRxiv - Neuroscience 2024Quote: ... The Qiagen RNeasy kit (# NC9307831, Qiagen) was followed per manufacturer’s instructions and Trizol RNA isolation was completed ...
-
bioRxiv - Microbiology 2024Quote: ... and PowerFood Microbial Kit (Qiagen, Germany) were selected and compared in terms of DNA yield ...
-
bioRxiv - Microbiology 2024Quote: ... DNeasy Blood & Tissue Kit (Qiagen, Germany), and PowerFood Microbial Kit (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: ... or QIAGEN Plasmid Midi kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... and RNeasy Mini Kit (Qiagen, #74106). Total RNA concentration and RNA integrity number was determined using a Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Immunology 2023Quote: ... combined with RNeasy Mini Kit (QIAGEN) and processed using a TruSeq Stranded mRNA Sample Prep kit (Illumina) ...
-
bioRxiv - Cell Biology 2024Quote: The DNeasy Blood & Tissue Kit (QIAGEN) was used according to the manufacturer’s instructions to extract mtDNA from mouse liver for injection into wound beds ...
-
bioRxiv - Cell Biology 2024Quote: ... the DNeasy Blood & Tissue Kit (QIAGEN) was utilized following the manufacturer’s instructions to isolate the cell-free mtDNA in plasma and cell supernatant ...
-
bioRxiv - Microbiology 2024Quote: The DNeasy PowerSoil Pro Kit (Qiagen) was used to extract bacterial DNA from the fecal pellet by following the instructions of the manufacturer ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Cancer Biology 2021Quote: Protein lysate [1μg/μL] was RNase A digested at 37°C for 15 min following addition of 1 μg RNase A (Qiagen) per 25 μg protein ...
-
bioRxiv - Immunology 2021Quote: Conditioned medium of HEK293 cells producing recombinant sema3A fused with 6xHistidine tag in C-terminal was collected and purified using Ni-NTA agarose beads (QIAGEN). The protein activity was assessed using the cytoskeleton collapse assay (19 ...
-
bioRxiv - Genetics 2020Quote: ... Ligation was carried out overnight at 16°C followed by overnight cross-link removal with 20mg/ml Proteinase K (Qiagen). The samples were purified using phenol-chloroform and ethanol precipitated resulting in 3C libraries ...
-
bioRxiv - Genomics 2020Quote: ... 25ng of the purified product was subjected to self-ligation at 16 °C overnight in a total volume of 50uls and column purified using Qiagen (Qiagen) PCR purification kit as per manufacturers recommendations ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cell pellets were resuspended in lysis buffer and stored at -80°C before DNA or total RNA extraction with the Genomic DNA Mini (Blood/Culture Cell) (Genesis) or mRNAeasy (Qiagen) kits ...
-
bioRxiv - Biophysics 2022Quote: ... Purified protein was diluted in PBS buffer (pH = 7.2) and the fluorescence intensity was recorded at 60 °C in the Rotor-Gene 6600 real-time PCR cycler (Qiagen) for 18 h ...
-
bioRxiv - Genomics 2019Quote: ... with the addition of 20 μl of proteinase K (20 mg/ml) followed by incubation at 56°C for 1-2 hr and the mitochondrial DNA was extracted by Qiagen DNeasy Blood & Tissue Kit (QIAGEN Inc.) ...
-
bioRxiv - Microbiology 2019Quote: ... medium at 37°C and was made competent with rubidium chloride according to the method provided in the QIAexpressionist manual protocol 2 (Qiagen). When antibiotic selection was required ...
-
bioRxiv - Cell Biology 2019Quote: The decellularized Balb/c mouse pancreas scaffolds were washed in PBS and homogenized-lysed for 1 hr in Tissue homozilyser II (Qiagen). The ECM proteins were dissolved in lysis buffer containing Tris HCl 0.06M ...
-
bioRxiv - Genetics 2019Quote: ... Crosslinking was then reversed by overnight incubation at 65°C and DNA purified using QIAquick PCR purification column (Qiagen, 28104). Immunoprecipitated DNA was then quantified via Qubit (ThermoFisher ...
-
bioRxiv - Physiology 2019Quote: ... 72 °C - 10 min) and amplicons separated using a Qiaxcel Advanced Separation System using 15 - 3000 bp markers (Qiagen, UK).
-
bioRxiv - Biochemistry 2021Quote: ... The insoluble fraction was precipitated by ultracentrifugation (20,000 g) for 30 minutes at 4°C and the supernatant was loaded onto a Ni-NTA superflow affinity column (QIAGEN). The Ni-column was then wash three times and eluted with buffer containing 30 mM HEPES (pH 7.8) ...
-
bioRxiv - Immunology 2021Quote: ... Samples were then centrifuged and plasma isolated and stored at -20°C prior to testing in the QuantiFERON IFNγ ELISA (Qiagen). Acceptance criteria for the assay specified by manufacturers were always met.
-
bioRxiv - Neuroscience 2020Quote: ... at 60°C overnight and 1 μl of a 1:20 dilution of the lysate used in a PCR reaction (HotStarTaq, Qiagen). The sequence flanking the tmt-opsin1b TALEN binding sites was amplified using the forward 5’-GGGACTTTCTTTGCGCTTTA-3’ and the reverse 5’-CAGGTCAGAGCGGATCTCAT-3’ primers ...
-
bioRxiv - Biochemistry 2021Quote: ... the cell lysate was cleared by centrifugation (20000 rpm, 30 minutes, 4 °C) and purified using Ni2+-affinity chromatography (Ni-NTA superflow cartridges, Qiagen). Typically two 5 mL columns were used for a 2 L culture in which the lysate was loaded on the column washed with 10 CV wash buffer (50 mM Hepes ...
-
bioRxiv - Biochemistry 2021Quote: ... the cell lysate was cleared by centrifugation (20000 rpm, 30 minutes, 4 °C) and purified using Ni2+-affinity chromatography (Ni-NTA superflow cartridges, Qiagen). Typically two 5 mL columns (flow 5 mL/min ...
-
bioRxiv - Biochemistry 2020Quote: Initial crystals of Nup133NTD-VHH-SAN5 were obtained at 18°C in 1 day as part of the Protein Complex suite (Qiagen) in a 96-well sitting drop tray with a reservoir containing 15% PEG MME 2,000 ...
-
bioRxiv - Bioengineering 2021Quote: ... Exosome samples were treated with 1 µL RNAse A/T1 per 100 µL sample for 30 min at 37°C and lysed in 650 µL of QIAzol (Qiagen). To monitor the RNA recovery percentage as a function of the isolation procedure ...
-
bioRxiv - Biochemistry 2020Quote: ... The supernatant obtained after high speed centrifugation (20 000 x g for 30 min at 4 °C) was loaded on a gravity nickel-nitrilotriacetic acid (Ni-NTA) metal affinity column (Qiagen), washed with 10 column volumes (CV ...
-
bioRxiv - Plant Biology 2021Quote: ... The translation mixture was gently agitated in a microtube for 1 h at 4°C with a fivefold volume of Ni-NTA agarose (Qiagen) that had been equilibrated with a solution containing 50 mM Tris-HCl (pH 7.5 ...
-
bioRxiv - Microbiology 2020Quote: ... Purified extracellular WT and Δtgif2k-b tachyzoites were treated with vehicle or 5 μM sodium arsenite for 2 h at 37°C and total RNA was extracted using RNeasy (Qiagen). The RNA concentration for each sample was measured using Nanodrop One (Thermo Scientific) ...
-
bioRxiv - Genomics 2021Quote: ... Samples were incubated for 15 min at 37 °C to methylate accessible chromatin before the reaction was stopped with the addition of RLT plus buffer (Qiagen) and samples frozen down and stored at −80 °C before processing ...
-
bioRxiv - Biophysics 2021Quote: ... NF-κB molecules were immobilized through the 6xHis-tag on the C-terminus of RelA by penta-His antibody biotin conjugate (34440, Qiagen). For DNA-bound NF-κB experiments ...
-
Pou3f1 orchestrates a gene regulatory network controlling contralateral retinogeniculate projectionsbioRxiv - Developmental Biology 2022Quote: ... Sorted ßGal+ or GFP+ cells were collected in 1.5ml DNA LoBind® tubes placed at 4°C containing 400µl RLT buffer (Qiagen, 79216) with 1% β-Mercaptoethanol (Millipore Sigma ...
-
bioRxiv - Biochemistry 2022Quote: ... The Klenow polymerization reactions were incubated at 37 °C for 1 h and then purified on ion-exchange cartridges (cat. no. 28306; Qiagen). The 194 purified reactions were dissolved in 50 µL of water each and pooled to generate the 3,880 members library (DEL3880 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Library plasmid pools were propagated in liquid culture in LB with ampicillin (100 μg/ml) at 30 °C overnight and extracted (Qiagen).
-
Evolutionarily divergent mTOR remodels the translatome to drive rapid wound closure and regenerationbioRxiv - Developmental Biology 2021Quote: ... The samples were powderized with a mortar and pestle under liquid nitrogen or a TissueLyser II chilled to -80°C (Qiagen). The samples were lysed in RIPA buffer for 30 min on ice with intermittent vortexing (0.15M NaCl ...
-
bioRxiv - Cell Biology 2019Quote: ... the manufacturer’s directions were followed with the exception of adding 500ul of 10% SDS (w/w) to the homogenate at 60°C for 20 minutes before the addition of P2 buffer (Qiagen). This allowed the brain tissue to better solubilize with the Qiagen buffers ...
-
bioRxiv - Microbiology 2020Quote: ... Tissue sections were incubated with proteinase K for 18h at 56°C prior to extraction on the QiaSymphony (Qiagen, USA) following manufacturer recommendations ...
-
bioRxiv - Biochemistry 2022Quote: ... Cell debris were removed by centrifugation (35,000 g at 4°C for 20 min) and the N-terminal His-tagged proteins were purified from the supernatant using NiNTA agarose (Qiagen) according to the manufacturer’s instructions ...