Labshake search
Citations for Qiagen :
1501 - 1550 of 3689 citations for 6 Chloro 4 hydroxy 2 methyl 2H thieno 2 3 e 1 2 thiazine 3 carboxylic acid methyl ester 1 1 dioxide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2020Quote: ... 45 min at 4 °C) and supernatant containing His-tagged proteins were purified by nickel-nitrilotriacetic acid (Ni-NTA) purification (Qiagen). Protein was eluted in a final elution buffer of 20 mM Tris pH 8.0 ...
-
bioRxiv - Developmental Biology 2020Quote: Total RNA was isolated from 3 months old Pgrcre and FOXL2OE diestrus uteri using RNeasy mini kit (Qiagen). The library was prepared using TruSeq RNA Library Prep kit (Illumina ...
-
bioRxiv - Immunology 2021Quote: ... and probe (375 nM, 5’-6FAM-ACACTAGCC/ZEN/ATCCTTACTGCGCTTCG-IABkFQ-3’) with 12.5μL of 2X QuantiFast Probe Mix (QIAGEN), 0.25μL of 2X QuantiFast RT Mix (QIAGEN) ...
-
bioRxiv - Cell Biology 2019Quote: ... and SHARPIN siRNA (5’-GCUAGUAAUUAAAGACACAd(TT)-3’) and the scramble Allstars negative control siRNA were ordered from QIAGEN. Gene silencing was performed using siRNA oligonucleotides and Lipofectamine RNAiMax reagent (13778150 ...
-
bioRxiv - Microbiology 2021Quote: ... Protein lysates were separated on NuPage 5-12% Bis-Tris or 3-8% Tris-Acetate gels (Novex, Qiagen) using MES running buffer (Novex ...
-
bioRxiv - Plant Biology 2022Quote: ... Total RNA was extracted from 3-day-old seedlings using a QIAshredder and RNeasy Plus Mini Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... 1000 µL PBS was added to each sample (lungs, 0.01–0.04 g) along with Tungsten carbide 3 mm beads (Qiagen). Samples were homogenized at a speed of 10 Hz for 10 min and then centrifuged at 15,000 × g for 10 min ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Samples were then ground to powder using a 3 mm tungsten carbide bead (Qiagen Cat. No. / ID: 69997) on a TissueLyser II (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... homogenized in sterile 0.05 % NP40 in H2O for 3 minutes at 25 Hz using a Tissue Lyzer (Qiagen) and serial dilutions were plated on YPD agar containing 100 μg/ml Ampicillin ...
-
bioRxiv - Neuroscience 2021Quote: ... neurons were transfected at 3 DIV with siRNA targeting Kdm6a or ntRNA using Effectene Transfection Reagent (Qiagen, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... 500 µl of PBS-AB was added to each sample along with Tungsten carbide 3 mm beads (Qiagen). Samples were homogenized during 10 min and then centrifuged at 15,000 g for 10 min ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were then washed 3 times with PBS and lifted with 500µL/well of Cell Protect Reagent (Qiagen) for 5 min ...
-
bioRxiv - Developmental Biology 2019Quote: ... The products from 3 to 5 PCR reactions were pooled before purifying the DNA on MinElute columns (Qiagen).
-
bioRxiv - Developmental Biology 2020Quote: ... benthamiana leaves were grinded in a tube with two glass beads (3 mm) with a TissueLyser II (Qiagen) and directly after supplied with 600 μl EB ...
-
bioRxiv - Microbiology 2019Quote: ... RNA samples from 3 independent cultures for each strain (Chr_dam and Chr_gfp) were extracted with RNeasy miniprep kit (Qiagen). Primers used are listed in Table S1 ...
-
bioRxiv - Genetics 2021Quote: Total RNA was extracted from an aliquot of 3 x 106 cells using the RNeasy Plus Kit (Qiagen). cDNA was synthesized from extracted RNA using the iScript cDNA Synthesis Kit (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... genomic DNA was isolated from HEK293T cells 3 days after transfections using the Gentra Puregene Cell Kit (Qiagen) and was diluted to 10 ng/μL ...
-
bioRxiv - Molecular Biology 2022Quote: ... washed 3 times with PBS and had their genomic DNA extracted with the QIAamp DNA mini kit (QIAGEN). Sequencing libraries were prepared at GenomeScan (Netherlands ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... For experiments with HURP knockdown the custom siRNA with 5’ to 3’ sequence used was AGUUACACCUGGACUCCUUTT (Qiagen, 1027423).
-
bioRxiv - Cell Biology 2022Quote: ... RNA was isolated from 0 or 3% CSE-treated bronchospheres using the Qiagen RNeasy Mini Kit (Qiagen 74106). The RNA yield was measured using Agilent TapeStation (4200 TapeStation System ...
-
bioRxiv - Microbiology 2023Quote: ... Individual mosquitoes were homogenized for 3 minutes at a 30Hz/s frequency in a TissueLyser II grinder (Qiagen). DNA extraction of individual larvae was carried out using the QIAamp DNA Kit (Qiagen ...
-
bioRxiv - Plant Biology 2023Quote: ... Genomic DNA was extracted from 3-week-old plants using the DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) following the manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2023Quote: ... LNA-CTG and the control scrambled LNA-modified sequence (LNA-SCB) 5′-GTGTAACACGTCTATACGCCCA-3′ were obtained from Qiagen as previously described in Rue et al 34
-
bioRxiv - Neuroscience 2023Quote: Total RNA was extracted from 3 dpf zebrafish AB larvae (50 fish) using RNAeasy Plus Kit (Qiagen 74134). cDNA was synthesized using SuperScript IV Reverse Transcriptase (Invitrogen) ...
-
bioRxiv - Microbiology 2023Quote: RT-qPCR was performed in an Applied Biosystems QuantStudio 3 using the QuantiTect® Multiplex PCR Kit (QIAGEN). The primers and probes used are listed in Table S2 ...
-
bioRxiv - Cell Biology 2023Quote: siRNA targeting human GPRC5A (siGPRC5A_4 against target sequence 5′-CTGGGTGTGTTGGGCATCTTT-3′, cat# SI04438021) and non-targeting control siRNA (cat# Ctrl_AllStars_1, target sequence not disclosed) were purchased from Qiagen. Human primary keratinocytes were transfected at 20 nM final siRNA concentration using Lipofectamin 2000 reagent (Life Technologies ...
-
bioRxiv - Genetics 2023Quote: ... Total RNA was then isolated for each biological replicate (3) using an RNeasy Lipid Tissue Mini kit (Qiagen). DNA contamination was removed using TURBO DNA-free (Ambion) ...
-
bioRxiv - Genomics 2024Quote: ... with two 3 mm metal beads and ground into a fine powder with a TissueLyser II (Qiagen, Germany) at 30 Hz for 2 min ...
-
bioRxiv - Microbiology 2020Quote: ... into 1 ml of RNA Protect solution (Qiagen, Hilden, Germany)
-
bioRxiv - Biochemistry 2022Quote: ... and incubated with 1 ml of Ni-Sepharose beads (Qiagen) on a rotator for 1 hour at 4°C ...
-
bioRxiv - Genomics 2019Quote: Each sample was lysed with 1 ml of QIAzol (QIAGEN). Total RNA was extracted using the miRNeasy system and protocol (QIAGEN) ...
-
bioRxiv - Systems Biology 2020Quote: ... cells were resuspended in 1 ml buffer RLT from Qiagen RNeasy kit ...
-
bioRxiv - Genetics 2019Quote: ... Columns were washed twice with 1 mL PE Buffer (Qiagen) then transferred to a micro-centrifuge and dried by spinning 1 minute at 16,100 × g ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and 1 μL of 100 mg/mL RNAse A (Qiagen). The samples were incubated for 30 min at room temperature ...
-
bioRxiv - Bioengineering 2021Quote: ... Supernatants were digested in 1 mg/ml Proteinase K (Qiagen) for 12 h at 55 °C then boiled for 10 min to inactivate the enzyme ...
-
bioRxiv - Cell Biology 2021Quote: ... Validated qPCR primers and primer assays (Qiagen, see Table 1) were used together with QuantiTect SYBR Green PCR kit (QIAGEN ...
-
bioRxiv - Microbiology 2022Quote: ... approximately 100 mg was stored in 1 ml RNAlater (Qiagen) for at least 4 days for stabilization ...
-
bioRxiv - Microbiology 2021Quote: ... was packed with 1 mL of Ni-NTA superflow (Qiagen). After washing with 10 mL of MilliQ water ...
-
bioRxiv - Immunology 2022Quote: ... and incubated with Penta-His-biotin conjugate 1:5000 (Qiagen) overnight ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cells were resuspended in 1 mL RLT Buffer (Qiagen 79216) and vortexed for 1 minute ...
-
bioRxiv - Genomics 2020Quote: ... 1 μl of diluted (0.08x) FastSelect rRNA HMR (Qiagen, Germany) and 1 μl of diluted (0.08x ...
-
bioRxiv - Genomics 2020Quote: ... 1 μl of diluted (0.08x) FastSelect rRNA HMR (Qiagen, Germany) was added into 6 μl COVID-19 specimen RNA along with 3 μl NA denaturation buffer ...
-
bioRxiv - Microbiology 2020Quote: ... 1 µg/ µl BSA and 10X HotStartTaq Master Mix (Qiagen). Cycling conditions included initial denaturation at 95°C for 15 min ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... and 1 mL of QIAzol lysis reagent (Qiagen, item #79306). Tissue homogenization was done by agitating the tubes for 20□s at a 7□m□s−□1 speed (Beadbug 6 homogenizer ...
-
bioRxiv - Microbiology 2021Quote: ... Tris 10 mM) supplemented with 1% Proteinase K (Qiagen #19133) and 1% RNAse A/T1 (ThermoFisher #EN0551 ...
-
bioRxiv - Biochemistry 2022Quote: ... was passed through a 1 mL NiNTA-agarose column (Qiagen) preequilibrated with the TRIS/urea buffer ...
-
bioRxiv - Microbiology 2023Quote: ... with the oligonucleotides for THP-1 cells (obtained from Qiagen) and P ...
-
bioRxiv - Microbiology 2022Quote: ... and 1 μL of 10 mg/mL RNase A (Qiagen), then incubating at 37°C for 1.5 hr without shaking ...
-
bioRxiv - Immunology 2023Quote: ... Total RNA was extracted from 1✕106 PBLs (Qiagen, 75144) and a reverse transcription reaction was performed to produce the DNA copy (Roche ...