Labshake search
Citations for Qiagen :
1501 - 1550 of 2214 citations for 5 Bromo 2 Tert Butyldimethylsilyl 4 Methylthiazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: Quantitative real-time PCR was performed in a volume of 5 mL QuantiTect Probe PCR Kit (Qiagen GmbH, Hilden, Germany) kit and an ABI 7900HT fast real-time PCR system (ThermoFisher Scientific Inc. ...
-
bioRxiv - Biophysics 2021Quote: ... The supernatant was collected and subjected to affinity purification using 5 mL Hi-Trap column containing Ni-NTA resin (Qiagen) on an AKTA Pure 25L protein purification system (GE Healthcare) ...
-
bioRxiv - Biochemistry 2021Quote: ... and cDNA products containing the R2R adapter attached to their 5′ end were cleaned-up by using a MinElute column (Qiagen) to remove unused primer ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Genetics 2021Quote: ... and E11 (5’-AGGAAAAAGGAAATAAATTA-3’) primers on pDH373 as a template generated a smaller fragment that was cleaned up by QIAGEN MinElute PCR Purification Kit (#28004) ...
-
bioRxiv - Genetics 2021Quote: Pools of 5 mites were ground to powder in liquid nitrogen and total RNA was extracted using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2021Quote: Cells were transfected at 60-80% confluence with 5 nM/1nM (MIN6, EndoCβ-H1, respectively) control or miR-125b mimics (Qiagen) or 50 nM of a mixture of four ONTARGETplus siRNAs against mouse Smad2 ...
-
bioRxiv - Biochemistry 2021Quote: ... The RNA was prepared from 5 OD equivalents of stressed and unstressed cells using the RNeasy Plus RNA Isolation Kit (Qiagen). 500 ng RNA of the total isolated RNA were used as a template for the synthesis of cDNA using Oligo(dT ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were then aspirated using a freshly flame-pulled patch pipette (2.5 inner diameter) and placed into a 5 μl of lysis Buffer TCL (Qiagen, 1031576) + 1% 2-mercaptoethanol (Millipore-Sigma ...
-
bioRxiv - Cell Biology 2022Quote: ... LRRCC1-si2 (target sequence: 5’- TTA GAT GAC CAA ATT CTA CAA - 3’) and control siRNA (AllStars Negative Control) were purchased from Qiagen. siRNAs were delivered into cells using Lipofectamine RNAiMAX diluted in OptiMEM medium (ThermoFisher Scientific) ...
-
bioRxiv - Molecular Biology 2021Quote: The ER-I-PpoI cells treated with 4-OHT (2.5 μM) for 1 hour were collected for extraction of the total nucleic acids using DNeasy Blood & Tissue Kits (Qiagen) or PureLink(tm ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from frozen mouse liver (20-25 mg) and HepG2 cells (5-6 million) using the AllPrep DNA/RNA Mini Kit (QIAGEN) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... and template-switching oligo (5′-AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3′, where “r” indicates a ribonucleic acid base and “+” indicates a locked nucleic acid base; Qiagen). cDNA was amplified using KAPA HiFi HotStart ReadyMix kit (Roche #KK2502 ...
-
bioRxiv - Cancer Biology 2020Quote: DNA and RNA were extracted from the cervical cancer tissues (5-10 mg) using the AllPrep DNA/RNA Micro Kit (QIAGEN) as described by the manufacturer ...
-
bioRxiv - Bioengineering 2020Quote: ... 100 ng equivalent of pooled total RNA (5 slices per animal; 7 rats) was used to synthesize cDNA using an RT First Strand Kit (Qiagen). Pre-validated primers targeting rat CXCR4 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The entire flies were mechanically crushed for 30 s at 25 Hz using a 5-mm stainless steel bead in a TissueLyser (Qiagen). Three hundred μL of ACL solution and 20 μL of 16 g.L-1 proteinase K were then added to the samples ...
-
bioRxiv - Plant Biology 2020Quote: ... Approximately 250 plants showing the long root phenotype of the revertant were selected at 5 DAS and pooled for DNA extraction using the DNeasy Plant Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2020Quote: ... followed by flow sorting with a Sony SH800Z (gating on calcein NVOC fluorescence levels) into individual wells of a 96-well plate containing 5 μL of Buffer RLT (Qiagen) and 1% β-mercaptoethanol.
-
bioRxiv - Cancer Biology 2021Quote: Driver mutations were derived from.15 CopyNumbers were calculated using the CNVKit package.16 RNA was isolated from cell cultures (+/− 5 μM AGI-5198) using the RNeasy kit (Qiagen). We performed paired-end sequencing of 2×100 with the Illumina Novaseq platform to obtain 8-10 GB per sample ...
-
bioRxiv - Neuroscience 2020Quote: ... 10 to 20 mg of frozen tissue was dissociated using 400 μl of RLT Plus in a 2mL extraction tube containing a 5 mm diameter beads (Qiagen) and agitated at 30 HZ for twice 2 minutes in the TissueLyser II (Qiagen) ...
-
bioRxiv - Microbiology 2021Quote: ... a volume equivalent to 5×108 cells were spun down (assuming 1 OD600=8×108 cells) and Protect Bacteria RNA Mini Kit (Qiagen) was used to extract total RNA as described in (Bhattacharyya et al. ...
-
bioRxiv - Neuroscience 2020Quote: RNA was extracted from third-instar larval CNS or adult heads (5-7 days post-pupation) with RNeasy Plus Micro kit (Qiagen). RNA isolation was followed with DNase digestion with Turbo DNA-free (Ambion) ...
-
bioRxiv - Microbiology 2021Quote: Bacterial cultures (5 to10 mL) from mid-exponential phase (OD600 = 0.5-0.6) were harvested and treated with RNAprotect reagent (Qiagen, Germantown, MD), and the cell pellet ...
-
bioRxiv - Microbiology 2020Quote: ... mexicana Cas9 T7 procyclic promastigotes were transfected either with whole PCR reactions or 5 µL of DNA purified using the QIAquick PCR Purification Kit (Qiagen). 8 x 106 log phase cells were prepared by spinning down (1,000 x g for 10 min) ...
-
bioRxiv - Systems Biology 2021Quote: ... 0.5-1 μg of total RNA was reverse transcribed into first-strand cDNA using an RT2 First Strand Kit (QIAGEN). The resultant cDNA was subjected to qPCR using human cytokine-specific primer (Realtimeprimers.com ...
-
bioRxiv - Plant Biology 2020Quote: ... All other tissues were homogenized in a SPEX CertiPrep 2010-230 Geno/Grinder (Cat No.: 12605297, Fischer Scientific) using 5 mm steel beads (Cat No.: 69989, Qiagen); tubes were shaken in 20 sec bursts at 1500 rpm ...
-
bioRxiv - Plant Biology 2021Quote: RNA was isolated from adult (5-week-old) WT and er/erl1/erl2 plants using a Plant RNeasy kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples from the GSK-3484862 and 5-azacytidine treated assays had RNA and DNA isolated simultaneously using the AllPrep DNA/RNA kit (Qiagen), whereas only RNA was isolated from decitabine samples by using the RNAzol total RNA protocol (Sigma) ...
-
bioRxiv - Plant Biology 2022Quote: Grains were homogenized using mortar and pestle with liquid nitrogen while other tissues were homogenized in SPEX CertiPrep 2010-230 Geno/Grinder (Cat No.: 12605297, Fischer Scientific) using 5 mm steel beads (Cat No.: 69989, Qiagen). For grain samples ...
-
bioRxiv - Plant Biology 2022Quote: RNA was extracted from 5-day-old vertically grown Arabidopsis thaliana seedlings root tissue using RNeasy Mini Kit (Qiagen, www.qiagen.com) with on-column DNA digestion to remove residual genomic DNA using RNase-free DNase according to manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... to produce 75-base pair single-end reads with aimed mean sequencing depth of >5 M reads per sample as recommended by the manufacturer (Qiagen).
-
bioRxiv - Microbiology 2021Quote: ... Blood was collected by cardiac puncture and harvested organs were homogenized in 500 μl PBS with two 5 mm stainless steel beads using a tissue lyser (Tissue-Lyser II, Qiagen) for two 2-minute rounds at 30 Hz and centrifuged to pellet debris for 10 minutes at 8,000 rpm ...
-
bioRxiv - Microbiology 2021Quote: ... placed in 250 μL PBS containing a 5 mm stainless steel bead and homogenized using a tissue lyser (Tissue-Lyser II, Qiagen) for 2-minutes at 30 Hz ...
-
bioRxiv - Microbiology 2020Quote: ... All samples were then passed 3-5 times through a 26G needle prior to RNA isolation using the RNAeasy mini kit from Qiagen. RNA concentrations were estimated by absorbance measurement at 260 and 280 nm ...
-
bioRxiv - Immunology 2020Quote: ... Equal volumes of barcoded PCR2 products (5 μL each) were pooled and PCR column purified using QIAquick PCR Purification Kit (Qiagen). Libraries were quantified using KAPA Library Quantification Kit for Illumina Platforms (Kapa Biosystems) ...
-
bioRxiv - Plant Biology 2021Quote: ... total RNA was extracted from 5-day-old wild-type and Mpatg mutant thalli using the RNeasy Plant Mini Kit (Qiagen) and used as a template for reverse transcription using SuperScript III Reverse Transcriptase (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... PCR triplicates of each cDNA (5 µL) were analyzed in a qPCR on a Rotor-Gene Q (Qiagen, Hilden, Germany) in a total reaction volume of 20 µL ...
-
bioRxiv - Microbiology 2020Quote: ... and a portion of the tissue (0.08-0.3g) was placed into pre-labeled microcentrifuge tubes containing 5 mm stainless steel beads (Qiagen Inc., CA). Lung samples were homogenized with DMEM + 2% FBS in a TissueLyser (Qiagen Inc. ...
-
bioRxiv - Biochemistry 2021Quote: ... imidazole (20 mM final) was added to the eluted protein which was subsequently incubated with 5 mL NiNTA resin (Qiagen) at 4 °C overnight with constant inversion ...
-
bioRxiv - Microbiology 2021Quote: ... qRT-PCR mixtures were assembled using 50 ng or 5 µl total RNA and QuantiTect Probe RT-PCR Kit (Qiagen). Amplification and analysis were performed using QuantStudio3 system (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... The digested DNA was separated on a 1% agarose gel and the ∼5 Kb genomic DNA band was harvested with a QIAquick Gel Extraction Kit (Qiagen). The DNA library was prepared according to the manual of the Ligation Sequencing Kit (Nanopore) ...
-
bioRxiv - Bioengineering 2021Quote: ... Total RNA (5 μl) was used for cDNA synthesis and qPCR was performed in one step using QuantiTect Probe RT-PCR (Qiagen) on a StepOnePlus System (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2022Quote: Qiagen miRCURY locked nucleic acid DIG (digoxigenin)-labeled probes (sense cATM-DIG: 5’DIG-AGTGGTTAGACAGTGATGTGT-DIG 3’) (Qiagen, Hilden, Germany) were used for ISH ...
-
bioRxiv - Genetics 2022Quote: ... The gRNA was amplified with oligos containing a 5’ T7 promoter sequence and purified using the QIAquick PCR purification Kit (Qiagen). RNA was generated using the Hiscribe™ T7 Quick High Yield RNA Synthesis Kit (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... from the top A horizon were immediately collected for DNA extractions in 15 mL tubes containing 5 mL Lifeguard Soil Preservation Solution (QIAGEN) using chilled soil-processing trays ...
-
bioRxiv - Cancer Biology 2022Quote: ... Red blood cells were eliminated by incubation for 10 min on ice with 5 mL of erythrocyte lysis buffer (Qiagen). Human cells were enriched using the Mouse Cell Depletion Kit and the QuadroMACS magnetic cell separator (Miltenyi Biotec ...
-
bioRxiv - Immunology 2022Quote: Clonal naïve GMP and neutrophil total RNA was extracted from cells at 5×106 cells/ml using the Qiagen RNeasy Plus Mini Kit (Qiagen) with DNaseI treatment (RNase free DNase Set ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were lysed by boiling (5 min 95°C) followed by bead beating (3mm beads, 30 Hz for 1 min) (TissueLyser II, Qiagen) and sonication bath (3×10 sec at 4°C ...
-
bioRxiv - Immunology 2020Quote: ... Within these gates CD8+MR1-5-OP-RU- and CD8+MR1-5-OP-RU+ T cell populations were sorted directly into lysis buffer for RNA isolation (RNeasy Plus Micro kit, Qiagen). Purity of ungated sorted CD8+humMR1-5-OP-RU+ cells was between 91-99% (Fig ...
-
bioRxiv - Plant Biology 2021Quote: ... Approximately 250 plants showing the long root phenotype of the revertant were selected at 5 DAS and pooled for DNA extraction using the DNeasy Plant Mini Kit (Qiagen) according to the manufacturer’s instructions ...