Labshake search
Citations for Qiagen :
1501 - 1550 of 3015 citations for 1 2 2 morpholin 4 ium 4 ylethoxy phenyl butan 1 one chloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... in length were extracted from a 2% agarose gel after electrophoresis and purified using a Qiagen Gel Extraction Kit (Qiagen, Hilden, Germany). The purified DNA was PCR amplified using GoTaq Colorless Master Mix (Promega ...
-
bioRxiv - Genomics 2020Quote: ... Realtime-qPCR was performed on 11 differentially expressed (DE) miRNAs based on miRNA-seq results (|FC| ≥ 2, P < 0.05) using miScript SYBR Green PCR Kit (Qiagen 218073, California, USA) according to the manufacturer’s instructions with StepOne Applied Biosystems real-time PCR machine (Applied Biosystems ...
-
bioRxiv - Neuroscience 2021Quote: ... 3-5 μg of DNA was isolated from frozen cortex of 2- and 12-month-old mice according to the manufacturer’s protocol (DNeasy Blood & Tissue Kit, Qiagen, Cat No. 69504) and diluted with 10 mM Tris ...
-
bioRxiv - Microbiology 2022Quote: SARS-CoV-2 RNA from the apical washes of the ALI HBE culture was isolated using QIAamp Viral RNA Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... HEK-293T cells were co-transfected with 0.15 µg of pCMV-Fusionred/SCN1B/SCN2B and 2 µg pcDNA3.1-SCN1A WT using 10 uL of PolyFect transfection reagent (QIAGEN; Germantown, MD, U.S.A.) in 35-mm culture dishes following the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2022Quote: ... The volume of mid-exponential phase culture to achieve 5 × 108 CFUs was calculated (assuming OD600 of 1.0 yields 109 CFUs/mL) and added to 2 volumes of RNAprotect Bacteria Reagent (QIAGEN, cat. no. 74124). The mixture was immediately vortexed for 5 sec ...
-
bioRxiv - Physiology 2022Quote: ... was broken up in 750 μl (TriFast USA) in a 2 ml Eppendorf (Hamburg, Germany) tube using the TissueLyzer (QIAGEN, Venlo, Netherlands) with stainless steel beads (5 mm) ...
-
bioRxiv - Physiology 2022Quote: ... Genomic DNAs of 61 weaned pups (2 pups died before weaning) were collected from their tails with a DNeasy Tissue kit (Qiagen, Valencia, CA). Six Ptger3-tTA BAC transgenic founder rats were identified by PCR for the presence of the tTAad-BGH insert ...
-
bioRxiv - Plant Biology 2022Quote: ... Tissue was ground to a fine powder at −80°C using 3-mm stainless steel beads at 50 Hz for 2*30 seconds in a TissueLyser LT (Qiagen, Germantown, USA). Ground samples were extracted with 1 mL of cold methanol containing [phenyl 13C6]-IAA (0.1 nmol/mL ...
-
bioRxiv - Genomics 2023Quote: Genomic DNA for the Pacific Bioscience Single Molecule Real-Time (SMRT) sequencing was prepared from 2 mL of fresh blood using the genomic-tip 100/G kit (Qiagen, Hilden, Germany). This was performed with additional RNase (Astral Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... 600 µl of lysis buffer (TES (0.1 M TRIS, 10 mM EDTA, 2% sodium dodecyl sulphate; pH 8) and Proteinase K (Qiagen, 20 mg/ml) in a 20:1 ratio ...
-
bioRxiv - Zoology 2023Quote: ... PCR products were amplified on a 2% agarose gel and amplicons were excised and cleaned using a gel purification kit (Qiagen, Hilden, Germany). Purified DNA was sequenced using both forward and reverse primers and Big Dye Terminator Cycling Sequencing at Azenta LLC (Plainfield ...
-
bioRxiv - Microbiology 2023Quote: RNA was extracted directly from the frozen samples with the addition of 2 ml of G2 DNA/RNA Enhancer (Ampliqon, Odense, Denmark) using the RNeasy PowerSoil Total RNA Kit (Qiagen, København, Denmark) with phenol:chloroform:isoamyl alcohol following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Aliquots of approximately 0.2 g of biomass pellets were further used for mDNA extraction also with the PowerLyzer® PowerSoil® DNA Isolation kit (QIAGEN).
-
bioRxiv - Plant Biology 2023Quote: ... QPCRs were run using the recommended protocol for 2× ProPlant SYBR Mix (Procomcure Biotech) on a Rotor-Gene Q (Qiagen, Hilden, Germany). Technical triplicates were performed for each sample ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA was treated with proteinase K at 42°C for 2 hrs and purified using MinElute PCR Purification Kit (Qiagen, Cat# 28004).
-
bioRxiv - Biochemistry 2023Quote: Mouse liver RNA was extracted from 10 mg (± 2 mg) of preserved tissue using RNEasy kits and QIAshredders (QIAGEN; Germantown, MD, USA). Aliquots of RNA from each sample were assessed on an Agilent 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Plant Biology 2023Quote: ... Collected tissue was ground to a fine powder at -80°C using 3 mm stainless steel beads at 50 Hz for 2*30 seconds in a TissueLyser LT (Qiagen, Germantown, USA), and between 10-15 mg of ground tissue per sample was used for auxin extraction ...
-
bioRxiv - Developmental Biology 2024Quote: ... Final PCR products of 250–500 bp were excised from a 2% agarose gel and purified using a gel purification kit (Qiagen, Catalog # 28604) according to the manufacturer’s instructions.
-
Epigenetic deregulation of IFN and WNT pathways in AT2 cells impairs alveolar regeneration (in COPD)bioRxiv - Cell Biology 2023Quote: Genomic DNA was extracted from 1-2×104 sorted alveolar epithelial cells isolated from cryopreserved lung parenchyma from 11 different donors using QIAamp Micro Kit (Qiagen, Hilden, Germany) following manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: ... PCR products were cleaned-up using 1:1 of SPRI beads and eluted in 30µl elution buffer (Qiagen). The resulting amplicons were assayed on the Fragment Analyzer System (Agilent) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 ml of the non-stressed culture was added to 1 ml of the RNAprotect Bacteria Reagent (Qiagen), vortexed and incubated for 5 min at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... Flow-through was mixed 1:1 with 70% ethanol and passed through a RNeasy Mini column (Qiagen, #74104). After centrifugation ...
-
bioRxiv - Biochemistry 2024Quote: ... ∼8 ml PCR product (azide-DNA:2xbiotin-DNA = 1:1) was purified using HiSpeed Plasmid Maxi kit (Qiagen) in 1 ml NaHCO3 (pH 8.3) ...
-
bioRxiv - Developmental Biology 2019Quote: ... One microgram of mRNA was converted to cDNA using Quantitect reverse transcriptase (Qiagen), and then diluted 1:10 for subsequent qRT-PCR analysis using SYBR Green JumpStart Taq (Sigma ...
-
bioRxiv - Microbiology 2019Quote: One µg of cDNA was synthesised using the QuantiTect reverse transcription kit (Qiagen) with the initial genomic wipe-out step included ...
-
bioRxiv - Genomics 2019Quote: ... RNA was extracted from one PBMC sample using the RNeasy mini kit (Qiagen). DNA was extracted from the other PBMC sample using the MagAttract HMW DNA kit (Qiagen).
-
bioRxiv - Genomics 2021Quote: ... One million enriched mESCs were lysed and RNA extracted using the RNeasy (QIAGEN) RNA extraction kit ...
-
bioRxiv - Neuroscience 2020Quote: ... One metal bead (Peqlab Biotechnologie GmbH, Germany) and 350 μl RLT buffer (Qiagen) including 1% β-mercaptoethanol was added to the frozen tissue parts ...
-
bioRxiv - Microbiology 2021Quote: ... the QIAcuity One-Step Viral RT-PCR Kit (Cat No. 1123145, Qiagen, Germany) and the 24-well 26K Nanoplates (Cat No ...
-
bioRxiv - Plant Biology 2020Quote: ... Initial amplification was carried out using a One-Step RT-PCR Kit (QIAGEN) in a BIO-RAD T100 Thermal Cycler ...
-
bioRxiv - Microbiology 2021Quote: ... The RT-PCR was performed using Qiagen One-Step RT-PCR kit (Qiagen) master mix ...
-
bioRxiv - Cell Biology 2022Quote: ... RT-PCR was performed using a One-Step RT-PCR kit (Qiagen, #210210) using the following primers Forward ...
-
bioRxiv - Molecular Biology 2021Quote: ... One microgram RNA was reverse transcribed using QuantiTect reverse transcription kit (QIAgen, UK). Ten nanograms of diluted cDNA in qPCR water (Roche ...
-
bioRxiv - Immunology 2021Quote: One million cells were resuspended in 600 μl of RLT Buffer (Qiagen; 79216) containing 1% 2-BME and snap frozen in a dry ice – ethanol bath for RNA isolation ...
-
bioRxiv - Microbiology 2020Quote: ... and RT-PCR carried out using the One-Step RT-PCR kit (Qiagen) according to the manufacturer’s protocols ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Primer extension reaction was performed with one unit of Taq polymerase (QIAGEN, Germany), 0.2 mM dNTP mixture ...
-
bioRxiv - Immunology 2022Quote: ... One-step qPCR was done with the QuantiNova SYBR Green qPCR Kit (QIAGEN) by using 20 ng RNA from each donor ...
-
bioRxiv - Molecular Biology 2022Quote: ... Genomic DNA was isolated one day later with Gentra Puregene Cell Kit (Qiagen). Amplicons for long-range sequencing were generated with Q5 High-Fidelity polymerase in 100 uL reactions (New England Biolabs ...
-
bioRxiv - Cell Biology 2023Quote: ... One µl of cDNA was added to SYBR Green PCR Master Mix (Qiagen) and subjected to PCR amplification (one cycle at 95°C for 20 seconds ...
-
bioRxiv - Microbiology 2023Quote: ... containing 500 µl PBS and one 5 mm steel bead (Qiagen, Hilden, Germany) prior to bead-beating for 20 seconds to disrupt the cuticle ...
-
bioRxiv - Immunology 2024Quote: ... Digital PCR reactions were run using the QIAcuity One Digital PCR System (Qiagen) in a 96-well 8.5k partitions nanoplate ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-His tag (1:2000; QIAGEN) and rabbit anti-GST (1:2000 ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA) (Qiagen, Hs_PLCE1_1, SI00115521); negative control siRNA (UUCUCCGAACGUGUCACGUdTdT ...
-
bioRxiv - Microbiology 2020Quote: ... 1× Qiagen Multiplex Master Mix (QIAGEN, Germany) and 5 μL of template DNA in a 15 μL reaction ...
-
bioRxiv - Developmental Biology 2022Quote: ... containing DNase I (1 mg/ml, Qiagen) at 37 °C for 5 min with gentle shaking ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 1 ml of Proteinase K (Qiagen, 19131) was added to the tube and vortexed for 5 seconds ...
-
bioRxiv - Systems Biology 2022Quote: ... resuspended in 1 mL QIAzol reagent (Qiagen) and stored at -80 °C.
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-His from Qiagen (1:10,000), home-made rabbit anti-VASH1 ...
-
bioRxiv - Cancer Biology 2019Quote: ... diluted 1:8 in PKD buffer (Qiagen) at 56°C for 1 hour with interval shaking ...