Labshake search
Citations for Qiagen :
1451 - 1500 of 10000+ citations for Tonsoku Like DNA Repair Protein TONSL Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... Power Biofilm DNA Isolation kits (Qiagen) were used for DNA isolation and DNA samples were stored in -80°C freezer ...
-
bioRxiv - Genomics 2024Quote: ... using MagAttract HMW DNA kit (Qiagen). The isolation protocol including RNase treatment followed the manufacturer’s recommendations ...
-
bioRxiv - Genomics 2024Quote: ... DNA was column purified (Minelute, Qiagen) and eluted in 130ul H2O for sonication with Covaris E220 model using the following settings ...
-
bioRxiv - Genomics 2024Quote: ... DNA was column purified (Minelute, Qiagen), and sonicated to a size distribution of 200-500bp ...
-
bioRxiv - Immunology 2024Quote: ... DNA was purified (MinElute kit, Qiagen) and analyzed on a TapeStation (Agilent) ...
-
bioRxiv - Biochemistry 2023Quote: ... Protein was precipitated in 80% ethanol and Automated Protein-Aggregation Capture (PAC) was performed on a BioSprint-96 (Qiagen) according to the following method ...
-
bioRxiv - Microbiology 2022Quote: ... α-His antibody (Qiagen) was used at 1:5,000 dilution to detect the presence of rRH5 in Native-PAGE.
-
bioRxiv - Cancer Biology 2021Quote: DNA and RNA was extracted from FFPE PDX tissue using the DNA FFPE Tissue Kit from (Qiagen) and RecoverAll Total Nucleic Acid Isolation kit (Ambion) ...
-
bioRxiv - Microbiology 2020Quote: Genomic DNA was extracted from ~10 g of thawed soil using Powermax Soil DNA extraction kit (Qiagen) with some minor modifications as follows ...
-
bioRxiv - Cell Biology 2020Quote: ... Genomic DNA was isolated from FACS-sorted populations using QIAamp DNA Blood Maxi kit (Qiagen, Cat #51192), and PCR-amplified with Q5 Hotstart high-fidelity 2X mastermix (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: The genomic DNA from clinical FFPE samples was extracted using QIAamp DNA FFPE Tissue Kit from Qiagen and quantified using Qubit from Thermo Fisher Scientific.
-
bioRxiv - Evolutionary Biology 2021Quote: ... Genomic DNA was extracted from 1 ml of overnight culture using a QIAamp DNA Mini Kit (Qiagen). Illumina MiSeq sequencing operated by the Functional Genomics Centre Zurich and Novogene (Cambridge ...
-
bioRxiv - Genomics 2020Quote: ... genomic DNA was extracted and purified using the QIAamp DNA Mini Kit from QIAGEN (catalogue number 51304). For most isolates ...
-
bioRxiv - Microbiology 2022Quote: ... DNA extraction for these metagenomes was carried out with the DNA Blood & Tissue kit (Qiagen, Hilden, Germany), whose protocol causes removal of free viruses ...
-
bioRxiv - Molecular Biology 2021Quote: ... Total genomic DNA extraction was performed using a commercial genomic DNA kit (DNeasy Blood & Tissue Kit, Qiagen). Photoproducts were quantified using a pre-optimized procedure (Thierry Douki ...
-
bioRxiv - Molecular Biology 2021Quote: ... High molecular weight genomic DNA was isolated using the Blood and Cell Culture DNA Mini kit (Qiagen). Flies were homogenised using a rotating pestle on ice for 1min ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... We extracted genomic DNA from tissue samples using the MagAttract High Molecular Weight DNA Kit from Qiagen following manufacturer’s instructions (Qiagen ...
-
bioRxiv - Genomics 2020Quote: Genomic DNA was isolated from kidney biopsies using QIAamp DNA Mini Kit (Cat# 51104, Qiagen, Hilden, Germany), obtaining ~30ng of DNA from 5000 cells ...
-
Histone deacetylase inhibitors butyrate and bufexamac inhibit de novo HIV-1 infection in CD4 T-cellsbioRxiv - Microbiology 2020Quote: ... total DNA from HIV infected cells was prepared using the Blood & Cell Culture DNA Mini Kit (Qiagen). The amount of 2-LTR circles was analyzed by quantitative PCR ...
-
bioRxiv - Genomics 2020Quote: Genomic DNA was extracted from the overnight culture using the QIAmap DNA Mini Kit (Qiagen, Hilden, Germany) as per the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... DNA cleanup was performed using the QIAamp DNA mini kit with the QIAcube instrument (QIAGEN, Valencia, CA). SNP-microarray using the HumanCytoSNP12 BeadChip platform (Illumina ...
-
bioRxiv - Molecular Biology 2019Quote: ... Cells were incubated for 24 hours and DNA was harvested with the QIAamp DNA mini kit (QIAGEN). Each experiment consisted of three biological replicates ...
-
bioRxiv - Microbiology 2019Quote: Total genomic DNA of the selected colonies was extracted using the DNeasy® DNA purification kit (QIAGEN) and ZR Fungal/Bacterial DNA MiniPrep™ kit (ZYMO Research ...
-
bioRxiv - Microbiology 2019Quote: ... Genomic DNA was extracted as previously described (16, 17) with the DNAeasy PowerSoil DNA extraction kit (QIAGEN).
-
bioRxiv - Evolutionary Biology 2020Quote: ... We extracted microbial DNA from the fecal samples using Qiagen’s PowerLyzer PowerSoil DNA Isolation kit (Qiagen #12855) following the standard protocol ...
-
Epigenetic Effects of Exposure to Insecticide on Early Differentiation of Mouse Embryonic Stem CellsbioRxiv - Pharmacology and Toxicology 2019Quote: DNA methylation was evaluated using an EpiTect Methyl II DNA Kit provided by Qiagen (Chatsworth, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2019Quote: ... DNA was isolated from the candidate mutants using a Qiagen plant genomic DNA kit (Qiagen, Valencia, CA). DNA was subjected to WGS using an Illumina HiSeq 2500 sequencer (2×125 bp) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Genomic DNA was isolated immediately after cell sorting using the QIAamp DNA Blood Mini Kit (QIAGEN, #51104) with yeast RNA (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2019Quote: DNA was extracted from swab exudates using the QIAamp DNA Mini Kit (Qiagen, Inc., Valencia, CA, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... Microbial genomic DNA extraction was carried out using QIAamp Fast DNA Stool Kit (QIAGEN, Valencia, CA, USA) following instructions from the manufacturer ...
-
bioRxiv - Genomics 2020Quote: ... cells were detached and genomic DNA was extracted using a Blood & Cell Culture DNA Maxi kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... DNA from fecal samples was extracted using the commercially available QIAamp DNA stool mini kit (QIAGEN Inc.), following the manufacturer’s protocol with slight modifications as mentioned in Mondol et al ...
-
bioRxiv - Genetics 2019Quote: Genomic DNA was isolated from 50 μl blood with the QIAamp DNA Mini Kit (Qiagen, Hilden, Germany), or from buccal swab with NucleoSpin Tissue Kit (Macherey-Nagel ...
-
bioRxiv - Developmental Biology 2021Quote: ... then genomic DNA was extracted from each sample of pooled embryos using QIAamp DNA mini kit (Qiagen) following the manufacturers’ recommendations ...
-
bioRxiv - Immunology 2021Quote: ... Genomic DNA was extracted from the blood using QIAamp DNA blood mini kit (Qiagen Science, Germantown, MD). The CMV viral load was performed as described previously92 ...
-
bioRxiv - Neuroscience 2020Quote: ... Genomic DNA extraction from the ear tissue was performed using the QIAamp Micro DNA kit (Qiagen, 56304) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2021Quote: DNA was extracted from biomass samples and purified using a QIAamp DNA Mini Kit (Qiagen, Inc., MD). The quality and quantity of DNA were checked using a NanoDrop Lite spectrophotometer (Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2020Quote: ... DNA was isolated using Qiagen MagAttract PowerMicrobiome kit DNA/RNA kit (Qiagen, catalog no. 27500-4-EP) on the EpMotion 5075 (Eppendorf ...
-
bioRxiv - Cancer Biology 2021Quote: ... total DNA was extracted from the organs of the engrafted mice using QIAamp DNA Mini Kit (Qiagen), and 40 ng were amplified using human specific Alu sequences as previously described (Knips et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... Extracted DNA was used for genotyping by polymerase chain reaction (PCR) (Taq DNA polymerase, Qiagen, Hilden, Germay), using primers flanking the endogenous CAG repeat in exon 10 of the murine Atxn3 gene (primer sequences ...
-
bioRxiv - Plant Biology 2021Quote: ... DNA extractions were performed on mechanically lysed samples using the PowerPlant Pro DNA isolation kit (Qiagen, CA), following the protocol described by Solanki et al ...
-
bioRxiv - Microbiology 2020Quote: ... The obtained pellets were used for DNA extraction using PowerSoil™DNA Isolation kits (QIAgen, CA, USA). DNA extracts were stored at -20 °C until further analysis.
-
bioRxiv - Microbiology 2021Quote: ... Total DNA was extracted from soil samples using the PowerLyzer PowerSoil DNA Isolation Kit (Qiagen, Hilden, Germany) from 250 mg of soil ...
-
bioRxiv - Immunology 2020Quote: ... the genomic DNA of selected clones was purified following the manufacturer’s protocol (Qiagen, QIAamp DNA mini kit). Ddx50 was amplified using the primer pair gagcgtccttcctggagattg / ctcaagtctgcccatctctcg and DDX50 was amplified using the primer pair ctgtgtcaccaggtggcatg / gactcgtgtaactttctttccc ...
-
bioRxiv - Genomics 2021Quote: ... before proceeding to DNA purification using a BioSprint DNA Blood Kit on a BioSprint 96 Workstation (Qiagen), using protocol “BS96 DNA Tissue” as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: DNA and RNA were isolated from cells using the AllPrep DNA/RNA Mini Kit (Qiagen, Cat: 80204). Briefly ...
-
bioRxiv - Microbiology 2021Quote: ... Genomic DNA was extracted from 112 Egyptian isolates using the QIAamp DNA Mini Kit (QIAGEN, Crawley, UK), according to manufacturer’s instructions and DNA concentrations were quantified using a Nanodrop spectrophotometer before genome sequencing using an Illumina MiSeq (California ...
-
bioRxiv - Microbiology 2019Quote: ... DNA was extracted from stool samples using a combination of the QIAamp DNA Stool Mini Kit (QIAGEN) following the manufacturer’s instructions and a mechanical disruption ...
-
bioRxiv - Cancer Biology 2021Quote: DNA was extracted from macro-dissected regions (Extended Data Fig.1E) using GeneRead DNA FFPE kit (Qiagen) and submitted to Adaptive Biotechnologies (Seattle ...
-
bioRxiv - Immunology 2022Quote: ... Genomic DNA was extracted from sort-purified cells from 22 patients by QiaAmp DNA micro kit (Qiagen). For reliable identification of expanded clones ...