Labshake search
Citations for Qiagen :
1701 - 1750 of 10000+ citations for Tonsoku Like DNA Repair Protein TONSL Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2022Quote: DNA extraction was performed on QIAsymphony instrument using the QIAsymphony DNA Investigator Kit and protocol (Qiagen, Hilden, Germany). DNA was quantified on Rotor-Gene Q real-time PCR cycler (Qiagen ...
-
bioRxiv - Genomics 2022Quote: ... DNA was extracted from histology blocks for these gonad tissue samples using the PAXgene Tissue DNA Kit (Qiagen) with modifications specified below ...
-
bioRxiv - Genomics 2022Quote: Genomic DNA was extracted using the Blood & Cell Culture DNA Mini (<5M cells) Kits (Qiagen, cat. no. 13323) as per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2019Quote: ... Genomic DNA was extracted from peripheral blood samples using DNA extraction kit according to the instruction (Qiagen, US). The presence of APOE ε 4 allele was analysed and performed using the well-validated PCR-RFLP method [24].
-
bioRxiv - Genetics 2019Quote: DNA was extracted from peripheral venous blood samples using the QIAamp DNA Mini Kit (Qiagen, Valencia, CA, USA). Genotyping was carried out by a technician blind to other data from the research project ...
-
bioRxiv - Genomics 2019Quote: The genomic DNA was extracted from 200 μl blood samples with the QIAamp DNA Blood Mini kit (Qiagen), and from the skin samples with a standard phenol-chloroform method ...
-
bioRxiv - Genomics 2019Quote: DNA was extracted from 200 µl breast milk using a QIAamp® DNA mini kit (QIAGEN, Manchester, UK), and viral DNA load was measured using an in-house HCMV gB TaqMan assay run on an Applied Biosystems® 7500 fast real-time PCR system (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2019Quote: Organoids were dissociated and DNA was isolated using the QiaSymphony DSP DNA mini kit (Qiagen, cat. No. 937236). Libraries were prepared using the Truseq DNA nano library prep kit (Illumina ...
-
bioRxiv - Molecular Biology 2019Quote: ... The tissues were subjected to genomic DNA extraction using the QIAmp DNA mini kit (Qiagen, catalogue number 51304). DNA concentrations were measured by Nanodrop™ 1000 spectrophotometer (Thermo Fischer scientific ...
-
bioRxiv - Bioengineering 2019Quote: ... cells were harvested and genomic DNA was isolated using the “Blood & Cell Culture DNA Mini Kit” from Qiagen and according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... Genomic DNA from the tails was isolated with a QIAamp DNA Blood and Tissue Kit (Qiagen, Hilden, Germany), with all procedures as described in our previous report (29) ...
-
bioRxiv - Microbiology 2020Quote: ... Single colonies where expanded and DNA was extracted using the DNeasy blood and tissue DNA isolation kit (Qiagen). Proper editing was verified by sequencing (Genewiz Inc. ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was extracted from 200 µl of sample suspension using the QIAamp DNA mini kit (Qiagen, Valencia, CA) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... with genomic DNA subsequently extracted using the QIAamp Fast DNA Tissue Kit protocol (QIAGEN© Corporation, Maryland, USA). To ascertain presence of high-quality genomic DNA (i.e. ...
-
bioRxiv - Microbiology 2019Quote: ... DNA was extracted from the cell pellet using the Qiagen Plant DNA Extraction Maxi Kit (Qiagen, Hilden, Germany). The remaining leaf material from the fungus gardens was photographed after the differential centrifugation ...
-
bioRxiv - Microbiology 2020Quote: Genomic DNA of the selected clone of both strains was isolated using QIAamp DNA blood mini kit (Qiagen) for whole genome sequencing using Illumina HiSeq 150 PE ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... DNA from whole faecal samples was extracted using the commercially available QIAamp DNA stool mini kit (QIAGEN Inc.), following the manufacturer’s protocol with slight modifications as mentioned in Mondol et al ...
-
bioRxiv - Microbiology 2020Quote: Genomic DNA was extracted from plant and soil samples using PowerSoil™ DNA Isolation kits (QIAgen, CA, USA). DNA extraction from soil and xylem sap followed the kit’s protocols ...
-
bioRxiv - Microbiology 2021Quote: Genomic DNA of Mtb positive cultures was purified from cleared lysate using a QIAamp DNA mini Kit (Qiagen). DNA libraries were prepared with Nextera XT kit (Illumina ...
-
bioRxiv - Immunology 2020Quote: DNA was extracted and purified from tissues using a QIAamp DNA FFPE Tissue kit (catalog no. 56404; Qiagen). Viral genome copy numbers were then determined for each tissue using quantitative PCR with primers specific to the chicken beta actin (CBA ...
-
bioRxiv - Microbiology 2019Quote: ... DNA was extracted from 10 g of sediment using the PowerMax Soil DNA Isolation Kit (12988-10, QIAGEN) according to the manufacturer’s protocol with minor modifications for the step of homogenization and cell lysis i.e. ...
-
bioRxiv - Genetics 2020Quote: Marmoset ESC (cj367) genomic DNA was extracted using the MagAttract HMW DNA Kit from Qiagen (Cat. No. 67563) (Hilden ...
-
bioRxiv - Microbiology 2021Quote: ... Bacterial DNA extraction from stool samples was performed using QIAamp Fast DNA Stool Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... Viral DNA and standard plasmid DNA were extracted using the QIAGEN DNeasy Blood and Tissue kit (QIAGEN #69504). qPCR reactions of serial-dilutions of the DNA samples were prepared using TaqMan Universal PCR Master Mix (ThermoFisher #4304437 ...
-
bioRxiv - Genetics 2021Quote: We extracted genomic DNA from cultured amniocytes of the proband using QIAamp DNA mini kit (Qiagen, Hilden, Germany). We performed 150 bp paired-end WGS using the short-read Illumina platform ...
-
bioRxiv - Cancer Biology 2020Quote: DNA from formalin-fixed paraffin-embedded tumor tissues was extracted using the QIAamp DNA FFpE Tissue Kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... genomic DNA was isolated from muscle or myonuclei using QIAamp DNA Micro and Mini Kit (Qiagen, Hilden, Germany). Myonuclei were isolated as previously described (Habib et al. ...
-
bioRxiv - Genomics 2021Quote: ... Cell pellets were used to extract genomic DNA using MagAttract high-molecular-weight (HMW) DNA kit (Qiagen, MD), following the manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2021Quote: ... The converted DNA was subjected to column purification and desulfonation on MinElute DNA spin columns (Qiagen, Cat 59824) with carrier RNA (Qiagen ...
-
bioRxiv - Genomics 2020Quote: Total genomic DNA was isolated from peripheral blood using the QIAamp DNA Blood Mini Kit (Qiagen, Hilden, Germany). Sequencing was performed in a time span from 2014 to 2020 ...
-
bioRxiv - Microbiology 2020Quote: Genomic DNA was extracted from soil and botanical samples using PowerSoil™ DNA Isolation kits (QIAgen, CA, USA). DNA isolation of soil (0.25 g ...
-
bioRxiv - Microbiology 2020Quote: The microbial DNA of gut content and fecal samples was extracted using Qiagen DNA extraction kit (Qiagen, Germany) according to the manufacturer’s protocols ...
-
bioRxiv - Immunology 2021Quote: ... was subjected to DNA isolation using the QIAamp DNA Blood Mini Kit on a Qiacube (both from Qiagen) instrument following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: We extracted DNA from cryopreserved buccal and colorectal biopsies using the PowerFecal DNA Isolation Kit (Qiagen, Valencia, CA). We then prepared sequencing libraries as described by the Earth Microbiome Project and sequenced them using the Illumina MiSeq Sequencer (Illumina ...
-
bioRxiv - Immunology 2020Quote: ... the total genome DNA of hemolymph microbiota was extracted using QIAamp® PowerFecal® DNA Kit (Qiagen, Germany). All samples were sequenced on Illumina Nova platform by a commercial company (Novogene ...
-
bioRxiv - Evolutionary Biology 2020Quote: DNA was extracted from pure culture isolates (Aquicella spp.) using the Genomic Tip 100 DNA extraction kit (QIAGEN), following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: DNA was extracted from dried blood spots using QIAmp DNA Blood kits per manufacturer’s protocols (Qiagen, Hilden, Germany). Extracted DNA underwent capture and sequencing using two MIP panels that have been previously described (15) ...
-
bioRxiv - Genetics 2020Quote: Genomic DNA was isolated from the blood and fibroblast samples using Gentra DNA extraction kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... genomic DNA from an aliquot of the sorted cell population was recovered using PureGene DNA isolation kit (Qiagen) and RBD amplified by PCR ...
-
bioRxiv - Immunology 2022Quote: ... Genomic DNA from whole-blood clot was extracted using the QIAsymphony DSP DNA Midi Kit (Qiagen, Valencia, CA). The DNA was quantified with NanoDrop and the extracted DNA was stored in −80°C until use for sequencing of the CDR3 regions of human TCRβ locus using the immunoSEQ assay ...
-
bioRxiv - Cancer Biology 2022Quote: ... for 24 hours at -20°C prior to DNA/RNA extraction with AllPrep DNA/RNA Mini Kit (Qiagen). Cryopreserved patient ascites cells and PDX cancer spheroids were thawed and rinsed in serum free RPMI before RNA/DNA extraction ...
-
bioRxiv - Evolutionary Biology 2022Quote: Total genomic DNA was extracted from each filter using the Qiagen PowerSoil DNA Isolation Kit (Qiagen, Hilden, Germany) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... Genomic DNA was harvested from the FACS sorted cells using QIAamp DNA Blood Maxi kit (Qiagen, Cat #51192), sgRNA libraries were prepared using Q5 HotStart High Fidelity (NEB ...
-
In-silico enrichment of bacterial plasmids by chromosomal depletion using nanopore adaptive samplingbioRxiv - Genomics 2022Quote: ... Klebsiella pneumoniae (GCF_025837075.1) and Enterobacter hormaechei (GCF_001729785.1) DNA was extracted using the QIAamp DNA Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instruction ...
-
bioRxiv - Genomics 2022Quote: ... converted DNA was amplified using primers Fwd 5’ TTGATGGAGTAAAAGGAATTGTTTTAGG and Rev 5’ CCAATTCAAAAATTTAAAAAAAACAAAACC with HotStarTaq DNA Polymerase (QIAGEN). The PCR conditions were ...
-
bioRxiv - Evolutionary Biology 2022Quote: Genomic DNA was isolated from whole blood using the Qiagen Blood and Tissue DNA kit (QIAGEN, Hilden, Germany). To measure CpG methylation ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... we grew single clones in monoculture with appropriate antibiotics overnight and extracted genomic DNA (QIAGEN Genomic DNA Kit) for library preparation with the Nextera XT Library Preparation Kit ...
-
bioRxiv - Immunology 2022Quote: DNA from faecal samples were extracted using a QIAamp Fast DNA Stool Mini Kit (Qiagen cat no. 51604) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... High molecular weight DNA was extracted from each section using the MagAttract HMW DNA Kit (Qiagen, Hilden, Germany) modified from manufacturer instructions to include gentle inversion to mix all components ...
-
bioRxiv - Microbiology 2022Quote: DNA was extracted using the Qiagen AllPrep PowerViral DNA/RNA extraction kit (Qiagen; Hilden, Germany; Cat. 28000-50) from a 200 μL aliquot of the L ...