Labshake search
Citations for Qiagen :
101 - 150 of 1755 citations for 6 Chloro 3 2 chloroethyl 1H pyrrolo 2 3 b pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... samples were thawed and homogenized with a single 3 mm Eliminase washed stainless steel ball bearing in for 3 min at 30 Hz (TissueLyser II, Qiagen) then purified by the Direct-zol RNA microprep kit (Zymo).
-
bioRxiv - Cell Biology 2021Quote: Total RNA from HGC (3 x 107 cells) and SPZEJ (3-30 x 107 cells) was extracted with the RNeasy Plus Mini Kit (Qiagen), and the purity and concentration of the extracted RNA was evaluated with the Agilent 2100 Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... miRNAs were extracted from plasma (n=3 adults, n=3 weaned pups) using a miRNeasy Serum/Plasma kit (Qiagen #217184). Enriched fractions were sent to Macrogen (South Korea) ...
-
bioRxiv - Cell Biology 2021Quote: To extract RNA from dissected aorta from amotl2ec+/ec+ (n=3) and amotl2ec-/ec- mice (n=3) was immersed in TRIzol and homogenised by TissueLyser (Qiagen) in TRIzol ...
-
bioRxiv - Neuroscience 2022Quote: sMN total RNA from DHMN1 patient (n = 3) and controls (n = 3) was isolated using the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNA was extracted from cell pellets as previously described (61), and all six RNA samples (3 acetate, 3 DIET) were cleaned with the RNeasy Mini Kit (Qiagen) and treated with Turbo DNA-free DNase (Ambion) ...
-
bioRxiv - Plant Biology 2023Quote: ... Arabidopsis thaliana frozen leaf tissues were weighed and ground by using two 3 mm stainless steel beads for 3 minutes at 30 Hz with frozen adapters on a TissueLyser II (Qiagen). The resulting frozen powder was dissolved in 650 µL chloroform-methanol (3:7 ...
-
bioRxiv - Plant Biology 2023Quote: ... samples were flash-frozen in liquid nitrogen immediately prior to grinding and ground using 3 mm glass beads at 30 Hz for 3 min in a TissueLyser II (Qiagen) to a fine powder ...
-
bioRxiv - Biochemistry 2020Quote: ... 3-4 mL of Ni-NTA resins (Qiagen) were applied on the gravity column ...
-
bioRxiv - Microbiology 2022Quote: ... resuspended in 3 ml RNAprotect Bacteria Reagent (Qiagen), divided into 3 × 1 ml aliquots (3 technical replicates) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3) QIAamp DNA Stool Mini Kit (QIAGEN®) and 4 ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’; Qiagen, Microsynth), si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’ ...
-
bioRxiv - Immunology 2021Quote: ... 3-4 pieces were placed into RNAlater (Qiagen) for gene expression analysis ...
-
bioRxiv - Physiology 2023Quote: ... Arf6 siRNA sequence: 5’- CAACGTGGAGACGGTGACTTA-3’ (QIAGEN SI02757286). QIAGEN All Stars Negative sequence was used as control.
-
bioRxiv - Cell Biology 2023Quote: ... and bL36m siRNA 5’-CGGTGGTACGTCTACTGTAAA-3’ (SI04156299, Qiagen).
-
bioRxiv - Microbiology 2024Quote: ... The 3 PCR amplicons were gel purified (Qiagen), added in equimolar quantities ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA was isolated at 6 time points (0, 0.5, 1, 2, 4, and 8 hours) using the RNeasy Mini kit (Qiagen) according to the manufacturer’s recommended protocol ...
-
bioRxiv - Microbiology 2019Quote: ... Real-time PCR assays were carried out in triplicate to amplify the Wolbachia wsp gene [43] and host reference gene GAPDH (378 F_ 5’-CCGGTGGAGGCAGGAATGATGT-3’, 445 R_5’-CCACCCAAAAGACCGTTGACG-3’) on a Rotor-gene Q Instrument (Qiagen, NSW, Australia). Reactions were run in a total volume of 10 μl having 5 μl Rotor-Gene SYBR® Green PCR Kit (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... ONTARGETplus Non-targeting siRNA oligo#1 (NT1) 5’-TGGTTTACATGTCGACTAA-3’ (Dharmacon, D-001810-01) and FlexiTube siRNA h USP31 oligo #1 (Q1) 5’-CCGAGTTCATGAAGACCTCAA-3’ (Qiagen, SI00758422), oligo #2 (Q2 ...
-
bioRxiv - Cell Biology 2023Quote: ... β-actin as housekeeping gene (Forward: 5’-CAGCCATGTACGTTGCTATCCAGG-3; reverse: 5’-AGGTCCAGACGCAGGATGGCA-3’) and 2X RT2 SYBR Green qPCR master mix (Qiagen, UK). The relative fold change in gene expression was analysed using the double delta Cq analysis (2-ΔΔCq ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: Fluorophore TYE665 labeled locked nuclear acid (LNA) (C4G2)6 and (CCG)8 probes (Supplemental table 2) were synthesized by Qiagen. The FISH protocol was adapted from (DeJesus-Hernandez et al ...
-
bioRxiv - Microbiology 2020Quote: ... HEK293T cells in 6-well plates were transfected with 2 μg pIRES2-eGFP or Trim-HA-NUP153 derivatives using Effectene (Qiagen). At 24 h post-transfection ...
-
bioRxiv - Biochemistry 2022Quote: 3×106 cells from the day 8 of CD34+ HSPC and day 6 of HUDEP-2 erythroid differentiation were used for total RNA using RNeasy Mini Kit (Qiagen). For reverse transcription using Primescript RT reagent kit (Takara Bio Inc.) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Amplification of cDNA for validation of doxycycline induction was performed with U2AF1 primers (forward: 5’-GGCACCGAGAAAGACAAAGT-3’; reverse: 5’-CTCTGGAAATGGGCTTCAAA-3’) and PCR products were purified using QIAquick PCR purification kit (QIAGEN, Cat #28104) before Sanger sequencing ...
-
bioRxiv - Microbiology 2022Quote: ... A wild-type virus stock NL4-3 was prepared by transfection of the pNL4-3 plasmid (purified using the Qiagen Plasmid Maxikit) into HeLa cells ...
-
bioRxiv - Plant Biology 2020Quote: Reduced His-tagged PRX-IIE (3 mg) or PRX-IIE C146S (3 mg) were bound to 1 mL Ni-NTA resin (Qiagen, Hilden, Germany) and used as affinity matrix ...
-
bioRxiv - Genomics 2019Quote: In order to screen for the presence of the Alu element in exon 4 of RP1 distinct pair of primers were designed (forward: 5′-AGGCTTGTTTCCTAGGAGAGGT-3′, reverse: 5′-TTCTGCTTCTTTTTCACTTAGGC-3′) using the CLCbio Genomics Workbench (Qiagen, Hilden, Germany).
-
bioRxiv - Microbiology 2020Quote: ... region was amplified using fungal-specific primers (60): ITS1F (5’-CTTGGTCATTTAGAGGAAGTAA-3’) and ITS4 (5’-TCCTCCGCTTATTGATATGC-3’) and the HotStarTaq Plus Master Kit (Qiagen, Valencia, CA). Amplicons from different samples were pooled to equimolar concentrations and purified of short fragments using Agencourt Ampure beads (Agencourt Bioscience Corporation ...
-
bioRxiv - Genomics 2021Quote: ... Total RNA was isolated from the VTM in a biosafety level-3 (BSL-3) laboratory using QIAamp viral RNA mini kit (Qiagen, Hilden, Germany) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... and 18S rRNA (5’-GAG CGA AAG CAT TTG CCA AG-3’ and 5’-GGC ATC GTT TAT GGT CGG AA-3’) on a Roter-Gene Q (Qiagen, Hilden, Germany) with 2x AmpiGene® qPCR Green Mix Lo-ROX (Enzo Biochem ...
-
bioRxiv - Microbiology 2022Quote: ... of the 16S rRNA gene that amplified via PCR using primers 338F (Seq: 5’-ACTYCTACGGRAGGCWGC-3’) and 1061R (Seq: 5’-CRRCACGAGCTGACGAC-3’) with the HotStar HiFidelity Polymerase Kit (catalog number 202602; QIAGEN, Hilden, Germany). Supplementary Figure 1 shows the 16S rRNA gene map and the primers used ...
-
bioRxiv - Microbiology 2024Quote: ... and homogenized in groups of 3-5 flies by bead-beating with 3 x 5 mm stainless steel beads (Qiagen, Hilden, Germany) in 1 ml 1X PBS ...
-
bioRxiv - Plant Biology 2022Quote: ... using 3-mm steel beads (Cat No.: 69997, Qiagen); tubes were shaken for 20-s at 28 Hz with dry ice.
-
bioRxiv - Evolutionary Biology 2022Quote: ... with two sterile 3 mm beads (Qiagen, Hilden, Germany) and a bead device at 20 Hz for 3 min ...
-
bioRxiv - Immunology 2020Quote: ... and prepared the QIAseq UPX 3’ Transcriptome Kit (QIAGEN). 10ng purified RNA was used for the NGS libraries ...
-
bioRxiv - Cell Biology 2019Quote: ... Kif5b#4 (target sequence 5′-CACGAGCTCACGGTTATGCAA-3′; Qiagen SI00176057), and non-target (NT ...
-
bioRxiv - Biochemistry 2019Quote: ... 3-4 mL of Ni-NTA superflow resin (Qiagen) were loaded onto a column and equilibrated with the resuspension buffer ...
-
bioRxiv - Microbiology 2020Quote: ... cells were lysed in 3 volumes RLT buffer (Qiagen) and RNA was extracted using Dynabeads MyOne Silane (Life technologies) ...
-
bioRxiv - Immunology 2021Quote: 1-3 × 105 PBMCs were lysed in QIAzol (Qiagen). Full-length cDNA was then synthesized using the SMARTer technology (Takara Bio) ...
-
bioRxiv - Biochemistry 2021Quote: ... using a TissueLyser II (3 min, 30 Hz; Qiagen). After vigorous mixing with chloroform at a 1:4 v/v ratio (chloroform:TRIzol) ...
-
bioRxiv - Genomics 2021Quote: ... 3 μl of nuclease free water (Qiagen, Hilden, Germany) and 5 μl of template containing cDNA ...
-
bioRxiv - Cell Biology 2022Quote: ... and oligo 5 (Q4) 5’-CACCGAGCTCTTCGCCGAGTA-3’ (Qiagen, SI03058272).
-
bioRxiv - Molecular Biology 2023Quote: ... for 3 min in TissueLyser II (30 Hz; Qiagen). Cell lysates were centrifuged for 15 min (4 °C ...
-
bioRxiv - Immunology 2023Quote: ... using tungsten carbide beads (3 mm, Qiagen catalog #69997) and shaking (300 times per min ...
-
bioRxiv - Physiology 2023Quote: ... using a TissueLyser II (3 min, 30 Hz; Qiagen). Lysates were centrifuged for 15 min (21,000 g ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 volumes of QIAzol® (Qiagen, Cat. No. 79306) were added to 80 µl of cell extracts ...
-
bioRxiv - Cell Biology 2019Quote: ... Transient transfections were carried out using just subconfluent cultures in 35 mm plates or in wells of a 6-well plate using DNA in the range of 0.3-2 µg/culture and the Polyfect reagent (Qiagen, Germantown, MD) and the manufacturer’s protocol ...