Labshake search
Citations for Qiagen :
1 - 50 of 1755 citations for 6 Chloro 3 2 chloroethyl 1H pyrrolo 2 3 b pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’, Qiagen), si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA #2: 5’-AGCGACTGAGCCGCTATAATA-3’ (SI04232011, Qiagen); #3 ...
-
bioRxiv - Cell Biology 2022Quote: ... oligo #2 (Q2) 5’-CCCGAAATATTTAGGCCTGAA-3’ (Qiagen, SI00758415) and oligo 5 (Q4 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... or a 3:2 mixture of QG buffer (QIAGEN) and isopropanol ...
-
bioRxiv - Cell Biology 2021Quote: ... 5’-ATGATCGATCATCTATAGCAA-3’ and 25nM S1PR1 #2 (Qiagen, #SI00376208) 5’-TAGCATTGTCAAGCTCCTAAA-3’ siRNAs or AllStars Negative Control siRNA (Qiagen ...
-
bioRxiv - Neuroscience 2021Quote: ... We pooled 2-3 fishes (6 weeks old) and extracted whole RNA using the RNAEasy Micro kit (Qiagen), with blood ...
-
bioRxiv - Cancer Biology 2023Quote: ... HGF (5’-CTCACACCCGCTGGGAGTAC-3’, 5’-TCCTTGACCTTGGATGCATTC-3’), STAT3 (5’-CTTTGAGACCGAGGTGTATCACC-3’, 5’-GGTCAGCATGTTGTACCACAGG-3’) and B-Actin Primer Set (Qiagen, QT00095431). After preparing master mixes samples were prepared in quadruplicate in a 96-well Reaction Microplates (Fisher Scientific ...
-
bioRxiv - Physiology 2022Quote: ... Fifteen milligrams of liver were homogenized in 200 µL of a 3:3:2 solution of acetonitrile:isopropanol:water (MeCN:IPA:H2O) in ceramic bead tubes (1.4 mm, Qiagen #13113-50) using a TissueLyzer II (Qiagen #85300) ...
-
bioRxiv - Microbiology 2023Quote: ... and homogenised with 3-5 mm steel beads in a TissueLyser II (Qiagen, 24 Hz, 2 × 3 min). 350 μL lysed blood or 200 μL lysed head kidney were transferred to a Magna Pure 96 Processing Cartridge (Roche) ...
-
bioRxiv - Neuroscience 2022Quote: ... using a TissueLyser (2 × 30 Hz, 3 min at 4°C; QIAGEN). After homogenization ...
-
bioRxiv - Plant Biology 2021Quote: ... immunodetection of RGS(His)6-tagged 14-3-3 was performed by applying the anti-RGS(His)6 antibody (Qiagen) in combination with a secondary anti-mouse HRP antibody.
-
bioRxiv - Cell Biology 2022Quote: Total RNA from patient material (n=3) and organoids (p1 and p2 n=3, p3 n=2) was extracted (RNeasy™ Mini Kit, Qiagen). To obtain cDNA ...
-
bioRxiv - Microbiology 2020Quote: ... in a 2 mL centrifuge tube for 3 min using a TissueLyzer (Qiagen). The obtained mixture was serially diluted in 5.0 mL sterile phosphate buffer and 150 µL aliquots of 10−4 to 10−7 dilutions were spread onto plates containing a range of media ...
-
bioRxiv - Cell Biology 2020Quote: ... phosphatase inhibitors 2 and 3) and then passing through Qiashredder columns (79656, Qiagen). Tissue samples were weighted ...
-
bioRxiv - Genomics 2024Quote: ... in a TissueLyser II apparatus (Qiagen Inc., USA; 2 × 3 min, 25 Hz). To remove phenol traces ...
-
bioRxiv - Plant Biology 2020Quote: Total DNA was isolated from 2-3 weeks old seedlings with DNeasy Plant Mini Kit (QIAGEN). 1ng of DNA per qPCR reaction was used as template ...
-
bioRxiv - Paleontology 2019Quote: Human 2 and 3: DNA was extracted from bones using QIAamp® DNA Investigator kit (56504, Qiagen). Bones were thoroughly washed (X5 ...
-
bioRxiv - Microbiology 2020Quote: ... and 6.25mL 2-mercaptoethanol (βME)) and homogenized at 30Hz for 3 min in a TissueLyzer II (Qiagen). 60 μL of 100% isopropanol was added to each tube and incubated for 1 min ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was isolated from pools of 2-3 organoids using RNeasy Plus Mini Kit (Qiagen, #74134) according to the manufacturer’s protocols ...
-
bioRxiv - Cell Biology 2023Quote: ... #3: 5’-AAGCATCGATAGGTAAGTTGA-3’ (SI03130008, Qiagen); #4 ...
-
bioRxiv - Genomics 2020Quote: ... for 1h at 37C and purified from a 2% agarose gel (QIAquick Gel Extraction Kit, Qiagen). In parallel ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’; Qiagen), si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’, Qiagen), si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’ ...
-
bioRxiv - Genomics 2020Quote: Total RNA of 2-3 million cells was isolated using miRNeasy Kit according to the manufacturer’s instructions (Qiagen). The quality of the RNA was assessed by a standard sensitivity NGS fragment analysis kit on Fragment Analyzer (Advanced Analytical Technologies) ...
-
bioRxiv - Developmental Biology 2022Quote: ... total RNA was extracted from 2-3 embryos pooled per genotype using the RNeasy Mini Kit (QIAGEN, 74106) and QIAshredder columns (QIAGEN ...
-
bioRxiv - Immunology 2023Quote: ... total RNA from 2 or 3 million peripheral blood mononuclear cells (PBMCs) was extracted (RNeasy Maxi Kit, Qiagen) from each time point (2015 (112 months p.i) ...
-
bioRxiv - Cell Biology 2021Quote: ... E2D2/3 (5’-AACAGUAAUGGCAGCAUUUGU-3’) and E2D4 siRNAs (5’ – CCGAAUGACAGUCCUUACCAA-3’) all from Qiagen, USA(83).
-
bioRxiv - Microbiology 2020Quote: ... Cells were mechanically disrupted by bead-beating for 2 × 3 min at 30 Hz (TissueLyser II, Qiagen, Hilden, Germany). The samples were incubated at −80°C for 10 min and at 95°C for 10 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... using the QIAGEN TissueLyser at 15 Hz for 2-3 min with a Stainless-Steel Bead (QIAGEN catalog # 69989). Phase separation was induced with chloroform ...
-
bioRxiv - Systems Biology 2020Quote: ... 3 mL of culture were mixed with 6 mL of RNAprotect bacteria reagent (Qiagen) and processed according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: Genomic DNA was extracted from fresh leaves of 2 to 3-week-old seedlings for all lines using a Qiagen MiniPrep Kit (Qiagen). Genotyping of all lines was performed using a custom lentil exome capture assay as described in Ogutcen et al ...
-
bioRxiv - Neuroscience 2020Quote: ... including miRNA was isolated from brains of E11 mouse fetuses (3 biological replicates) at 2 h after irradiation using the miRNeasy Mini Kit (Qiagen). RNA was subsequently processed for hybridization to GeneChip miRNA 4.0 microarrays (Affymetrix ...
-
bioRxiv - Neuroscience 2021Quote: ... (n=3 biological replicates) and TACs (hGFAP::GFP-, CD133-, EGFR+, CD24-) (n=2 biological replicates) using the miRNeasy kit (Qiagen). miRNAs were pre-amplified and profiled using TaqMan® Array Rodent MicroRNA A Cards v2.0 A as specified by the manufacturer at the Genome Technology Center of New York University Langone Medical Center ...
-
bioRxiv - Bioengineering 2022Quote: ... RNA was isolated from 3D samples (n=2-3) by combining a TRIzol-based cell lysis with a RNeasy Mini Kit (Qiagen). Samples were collected at aforementioned timepoints ...
-
bioRxiv - Developmental Biology 2019Quote: ... total RNAs were extracted from wild-type and Cables2-deficient EpiLCs at 2 days post-induction (n = 3) using RNeasy Plus Mini Kit (Qiagen). RNA quality was evaluated using Agilent Bioanalyzer with RNA 6000 Pico kit (Agilent Technologies Japan ...
-
bioRxiv - Developmental Biology 2019Quote: Total RNA was isolated from approximately 100 EBs (differentiation day 2 and 3) or 25 EBs (differentiation day 4 and 5) using RNeasy Mini kit (Qiagen). 0.5 μg RNA was transcribed to cDNA using QuantiTect Reverse Transcription kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2021Quote: ... for a total of 6 min (2 x 3 min with 1 min on ice in between homogenisations) at 50 Hz using a TissueLyser LT (Qiagen). Thereafter ...
-
bioRxiv - Plant Biology 2023Quote: Two-week-old Arabidopsis seedlings of Col-0 wild type and trb1/2/3 triple mutans were used for DNA extraction using DNeasy Plant Mini Kit (QIAGEN). A total of 500 ng DNA was sheared with Covaris S2 (Covaris ...
-
bioRxiv - Plant Biology 2023Quote: 7-day old in vitro grown plantlets or adult leaves of soil grown 3-4 week-old plants were ground in 2 mL tubes using a Tissue Lyser (Qiagen) twice for 30 sec at 30 Hz before RNA extraction using the RNeasy Plant Mini kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Tumours were harvested 2-3 weeks after transplantation and genomic DNA was extracted from tumours using the Gentra Puregene DNA Extraction kit (QIAGEN).
-
bioRxiv - Microbiology 2024Quote: ... 10 Arabidopsis seedlings from the same MS plate were sampled together in 2 mL microtubes containing two 3 mm-diameter tungsten carbide beads (Qiagen), and flash frozen in liquid nitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... vIL-6 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) using QuantiTect Multiplex RT-PCR Kits (Qiagen) as described previously (37 ...
-
bioRxiv - Cell Biology 2023Quote: ... for 1h at 37 °C (2 units per sample) followed by purification with the RNeasy miniElute Cleanup kit (Qiagen).
-
bioRxiv - Plant Biology 2020Quote: ... by shaking with two 3-mm glass beads for 2 min at 30 Hz with a Tissue-Lyser (Qiagen, Hilden, Germany). After 5 min in an ice-cold ultrasonic bath ...
-
bioRxiv - Epidemiology 2020Quote: ... then ticks were washed by gentle shaking over 2-3 min at 7 Hz/s in a Tissue Lyzer (Qiagen, Germany). After discarding the supernatant ...
-
bioRxiv - Neuroscience 2022Quote: ... or a non-targeting scrambled control (Scr; sequence: 5’-TAACACGTCTATACGCCCA-3; Qiagen, Cat No.: 339137; 0.1 nmol in 2 μL PBS), using a 2 μL Hamilton syringe at a rate of 1 μL/min ...
-
bioRxiv - Microbiology 2022Quote: ... 3 mL samples were added to tubes containing 6 mL RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany) and vortexed ...
-
bioRxiv - Immunology 2021Quote: ... RNA from each Xenopus embryo (n=2-3/condition) was separately extracted and purified using the RNeasy Micro Kit (Qiagen; Venlo, Netherlands) and microarray measurements were performed using the GeneChip Xenopus laevis Genome 2.0 Array (Affymetrix ...