Labshake search
Citations for Qiagen :
101 - 150 of 1995 citations for 6 BROMO 2 METHYL QUINOLINE 4 CARBOXYLIC ACID METHYL ESTER since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2019Quote: Total RNA was isolated from approximately 100 EBs (differentiation day 2 and 3) or 25 EBs (differentiation day 4 and 5) using RNeasy Mini kit (Qiagen). 0.5 μg RNA was transcribed to cDNA using QuantiTect Reverse Transcription kit (Qiagen) ...
-
bioRxiv - Microbiology 2019Quote: ... from the ME phase and ES phase (1 ml) were added to 4 ml and 2 ml of RNAprotect Bacteria Reagent (Qiagen), respectively ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Lysates were clarified by centrifugation at 24,000gat 4 °C for 20 min and passed through 2 ml of Ni-NTA nickel resin (Qiagen, 30250) pre-equilibrated with wash buffer ...
-
bioRxiv - Biochemistry 2019Quote: ... Cell lysate was separated by centrifugation at 28000 x g for 45 min and 4°C and the supernatant was loaded onto a column containing 2 mL of Ni-NTA agarose (Qiagen) equilibrated with buffer A for 1 h for purification by nickel affinity chromatography ...
-
bioRxiv - Biochemistry 2021Quote: ... The clarified extract was supplemented with 10 mM imidazole and rotated for 2 hours at 4 °C with 1 ml of Ni-NTA beads (Qiagen). Bound protein was eluted with 10 CV of buffer L / 200 mM imidazole ...
-
bioRxiv - Molecular Biology 2021Quote: ... Lysates were clarified by centrifugation at 24,000g at 4°C for 20 min and passed through 2 mL of Ni-NTA nickel resin (Qiagen, 30250) pre-equilibrated with wash buffer (20 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Biochemistry 2023Quote: ... the cell lysate was cleared by centrifugation (20L000 rpm, 30 minutes, 4 °C) and purified using Ni+2-affinity chromatography (Ni-NTA superflow cartridges, Qiagen). Typically two 5 mL columns (flow 5 mL/min ...
-
bioRxiv - Plant Biology 2023Quote: 7-day old in vitro grown plantlets or adult leaves of soil grown 3-4 week-old plants were ground in 2 mL tubes using a Tissue Lyser (Qiagen) twice for 30 sec at 30 Hz before RNA extraction using the RNeasy Plant Mini kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Microbiology 2023Quote: ... Pellets were washed in 2 mL cold 10 mM NaCl + 4 mL cold RNAprotect Bacteria Reagent (Qiagen Cat. No. 76506) and repelletted at 4,255 x g ...
-
bioRxiv - Genetics 2024Quote: ... PCR was performed with 2 µL (∼16 ng) or 4 µL (∼32 ng) of BT-converted DNA with HotStar Taq Polymerase (Qiagen), depending on the genomic region ...
-
bioRxiv - Genomics 2020Quote: ... and template-switching oligo (5′-AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3′, where “r” indicates a ribonucleic acid base and “+” indicates a locked nucleic acid base; Qiagen). cDNA was amplified using KAPA HiFi HotStart ReadyMix kit (Roche #KK2502 ...
-
bioRxiv - Genetics 2020Quote: Iron nitrilotriacetic acid (NTA) resin were prepared in-house by stripping metal ions from nickel nitrilotriacetic acid agarose resin (Qiagen) with 100 mM ethylenediaminetetraacetic (EDTA ...
-
bioRxiv - Genomics 2021Quote: ... Total Nucleic Acid (TNA) was extracted using automated nucleic acid extraction on the QIAsymphony and the DSP Virus/Pathogen Mini Kit (Qiagen). RNA isolation and library preparation is fully described in Butler ...
-
bioRxiv - Genomics 2023Quote: ... 1µM Template-Switching Oligo (5′-AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3′, where “r” prefixes a ribonucleic acid base and “+” prefixes a locked nucleic acid base, Qiagen) then incubated using a ThermoMixer C with the following conditions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... was ground to small pieces by one steel ball (Ø 4 mm) in a 2 ml Eppendorf tube with Tissue Lyzer II (Qiagen, Hilden ...
-
bioRxiv - Biochemistry 2020Quote: ... 4°C) an applied to a 2 ml Ni-NTA immobilised metal affinity chromatography (IMAC) gravity flow column (QIAGEN, Hilden, Germany). Columns were washed in 10 column volumes (CV ...
-
bioRxiv - Genomics 2022Quote: ... Day 145) for n=4 clams for each treatment (Figure 2) using the Qiagen DNeasy Blood and Tissue Kit (Qiagen USA) according to manufacturer’s instructions with slight modifications ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and ∼55 mg of total protein in CFE was incubated for 60 min at 4 °C with 2 mL of Ni-NTA agarose (QIAGEN, Germany) equilibrated with purification buffer A ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were centrifuged at 5000 g for 2 hours at 4 °C and the pellet was collected for DNA extraction with a DNeasy PowerSoil kit (Qiagen, Germany). The sediment from Lime Blue was collected with a freeze core (modified from Stocker and Williams ...
-
bioRxiv - Biophysics 2023Quote: ... dCas9-Halo protein was purified from the supernatant by incubating for 2 h at 4 °C with Ni-NTA agarose (Qiagen #30210). The beads were washed 10 times with 5 ml dCas9 wash buffer I (50 mM NaxPO4 pH 7.0 and 300 mM NaCl ...
-
bioRxiv - Biophysics 2023Quote: ... dCas9-Cys protein was purified from the supernatant by incubating for 2 h at 4 °C with Ni-NTA agarose (Qiagen #30210). The beads were washed 10 times with 5 ml dCas9-Cys wash buffer (20 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was extracted from OSU-CLL cells (1.5e6 cells/mL) treated with DMSO or SpiD3 (1, 2 μM; 4 h) using the miRNeasy Mini Kit (Qiagen; Hilden, Germany) per manufacturer instructions and processed using the Universal Plus mRNA-Seq with NuQuant kit (Tecan ...
-
bioRxiv - Cancer Biology 2022Quote: ... using the QIAamp Circulating Nucleic Acid kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... followed by a nickel-nitrilotriacetic acid column (Qiagen) and then dialyzed against buffer comprised of 10 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Molecular Biology 2024Quote: ... using the QIAamp Circulating Nucleic Acid kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... immunodetection of RGS(His)6-tagged 14-3-3 was performed by applying the anti-RGS(His)6 antibody (Qiagen) in combination with a secondary anti-mouse HRP antibody.
-
bioRxiv - Microbiology 2023Quote: ... The SCGs cultured in 6-well dishes and one entire 6-well was harvested and pooled together for RNA isolation (RNeasy, Qiagen) per sample ...
-
bioRxiv - Microbiology 2021Quote: ... Maize and soybean leaf and root tissue were pulverized for 2-min at a speed of 30 Hz with two 4-mm stainless balls in a TissueLyser II (Qiagen, Venlo, Netherlands). Total DNA was extracted from plant tissues with the OMEGA Mag-Bind Plant DNA Plus kit (Omega Bio-Tek ...
-
bioRxiv - Microbiology 2024Quote: ... The pellets were resuspended with OMV buffer and re-pelleted again by centrifugation at 100,000 g (31,000 RPM) for 2 h at 4°C and lysed with Qiazol followed by RNA isolation with the miRNeasy kit (Qiagen, Germantown, MD) to obtain total RNA including the small RNA fraction ...
-
bioRxiv - Neuroscience 2024Quote: ... 6 µl Hi-Perfect transfection reagent (Qiagen, 301707), and 1 µl of the desired (20 µM ...
-
bioRxiv - Biochemistry 2020Quote: ... Locked nucleic acid (LNA) ASOs were ordered from Qiagen and dissolved in water to 100 μM ...
-
bioRxiv - Biochemistry 2019Quote: ... mixed with nickel-nitrilotriacetic acid-agarose resin (NiNTA, Qiagen) and allowed to rotate end-over- end at 4°C for 4 hours ...
-
bioRxiv - Genomics 2021Quote: ... Using the QIAmp Circulating Nucleic Acid Kit (Qiagen, 55114) we followed two of the manufacturer protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... Nucleic acids were extracted using the RNeasy kit (QIAGEN). Contaminating DNA was removed using the Turbo DNA-free kit (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: The antisense locked nucleic acid (LNA) GapmeR (#339515, Qiagen) sequence for the Tug1 LNA was (5’-3’ ...
-
bioRxiv - Microbiology 2023Quote: ... nucleic acids were extracted (QIAmp DNA Mini Kit, QIAGEN) and a multiplex nested PCR was implemented to detect known skin-tropic HPyVs (MCPyV ...
-
bioRxiv - Genetics 2023Quote: ... nucleic acid was purified using QiaQuick (QIAGEN, Germantown, Maryland) and sent to Laragen for Sanger sequencing (Laragen ...
-
bioRxiv - Microbiology 2021Quote: Cellular total RNA was prepared from 2-4×106 cells for each sample using the RNeasy Plus Micro kit (Qiagen, Hilden Germany, #74034). For qRT-pCR ...
-
bioRxiv - Genomics 2021Quote: ... Quantification of ACE2 transcript levels was performed by preparing total RNA from 2-4×106 cells for each sample using the RNeasy Plus Micro kit (Qiagen, Hilden Germany, #74034). For qRT-pCR ...
-
bioRxiv - Molecular Biology 2022Quote: Viral RNA was extracted from serially diluted and the 4 different media SARS-CoV-2 samples using the QIAamp Viral RNA Mini Kit (QIAGEN GmbH, Hilden, Germany). Briefly ...
-
bioRxiv - Cell Biology 2023Quote: ... and siNET1 #4 (Qiagen cat# SI00082040 ...
-
bioRxiv - Cell Biology 2019Quote: ... coli lysates using a nickel-nitrilotriacetic acid superflow resin (Qiagen) then combined and sent for anti-sera production (Covance) ...
-
bioRxiv - Genomics 2020Quote: ... or the QIAmp Circulating Nucleic Acid Kit (Qiagen, Hilden, Germany), as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: A PowerSoil Deoxyribonucleic Acid (DNA) Extraction Kit (QIAGEN, Hilden, Germany) was used to extract genomic DNA from fecal samples according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... DNA was extracted using QIAamp Circulating Nucleic Acid kit (QIAGEN). We measured DNA yield using digital PCR assay22 ...
-
bioRxiv - Cell Biology 2020Quote: ... coli cell lysate using Ni-nitriloacetic acid agarose resin (Qiagen) under denaturing conditions according to the manufacturer’s guidelines ...
-
bioRxiv - Biophysics 2020Quote: ... clarified lysate was applied to Ni-NTA (nitrilotriacetic acid, Qiagen) resin for 1.5h ...
-
bioRxiv - Genomics 2020Quote: cfDNA was extracted using QIAamp Circulating Nucleic Acid Kit (Qiagen) with the Qiavac24s system ...
-
bioRxiv - Microbiology 2022Quote: ... and an automated nucleic acid purification system (QIAcube Connect; Qiagen). Each eluent was reverse-transcribed ...