Labshake search
Citations for Qiagen :
451 - 500 of 1995 citations for 6 BROMO 2 METHYL QUINOLINE 4 CARBOXYLIC ACID METHYL ESTER since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... nucleic acid extractions were performed by combining equal amounts of Lysis Buffer RLT (Qiagen, Germantown, MD, USA) with supernatant from clinical samples (swabs ...
-
bioRxiv - Microbiology 2021Quote: ... Nucleic acids were extracted from supernatants and pellets using the QIAamp Viral RNA Mini Kit (52906, Qiagen) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2022Quote: ... https://www.beiresources.org/).Protein was purified using gravity flow purification with Ni-nitrilotriacetic acid (NTA) agarose (Qiagen, Germany) and concentrated and buffer exchanged in Amicon centrifugal units (EMD Millipore ...
-
bioRxiv - Molecular Biology 2019Quote: ... Cell-free DNA was extracted from maternal plasma with QIAamp Circulating Nucleic Acid Kit (Qiagen, Dusseldorf, Germany). The cell-free DNA library was prepared using the KAPA Library Preparation Kit (Kapa Biosystems ...
-
bioRxiv - Microbiology 2019Quote: ... Total nucleic acid was extracted from 100 μl of supernatant using the QIAamp viral RNA kit (Qiagen) eluting in 50ul of H2O ...
-
bioRxiv - Molecular Biology 2020Quote: The MS2 RNA was purified from the phage particles using QIAamp Circulating Nucleic Acid Kit (Qiagen, Germany) accordingly to the manufacturer’s protocol and stored at −80°C.
-
bioRxiv - Biochemistry 2019Quote: ... Expressed protein was purified by elution from a nickel-nitrilotriacetic acid agarose (Ni-NTA) (Qiagen, Germantown, MD) column with 0.5 M imidazole and buffer exchanged into TEV buffer (25 mM NaHPO4 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The MBP eluate was then incubated with pre-equilibrated nickel-nitriloacetic acid resin (Ni-NTA agarose, Qiagen) for 60 mins in the presence of 20 mM imidazole ...
-
bioRxiv - Biochemistry 2021Quote: Locked Nucleic Acids (LNA) and miRNA mimics and scrambled LNA/mimic (negative control) was purchased from Qiagen and MOLM13 cells were transfected with either LONZA nucleofector devise (program X-001 ...
-
Stem cell-derived macrophages as a new platform for studying host-pathogen interactions in livestockbioRxiv - Immunology 2021Quote: ... 24 and 48 hours and nucleic acid extracted using Qiamp viral RNA mini extraction kit (Qiagen, #52904). Viral DNA levels were quantified by qPCR using primers and probe that detect the ASFV VP72 gene52 with the Quantifast Pathogen PCR kit (Qiagen ...
-
bioRxiv - Developmental Biology 2020Quote: ... DNA from brain regions was extracted using an automated nucleic acid extraction platform called QIAcube HT (Qiagen) with a column-based extraction kit ...
-
bioRxiv - Microbiology 2021Quote: ... and supernatants were collected for affinity purification over pre-equilibrated nickel-nitrilotriacetic acid (Ni-NTA) agarose (Qiagen) columns ...
-
bioRxiv - Microbiology 2023Quote: ... 0.5 and 0.1 μg) were allowed to bind 30 μl of nickel-nitrilotriacetic acid-agarose beads (QIAGEN) for 1 hour after which unbound decoy was removed by washing with PBS ...
-
bioRxiv - Microbiology 2022Quote: Viral nucleic acids were extracted with the QIAamp® Viral RNA Mini Kit (Qiagen, GmbH, Hilden, Germany) from 140 μl of culture supernatants collected following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... The subsequent isolation of nucleic acids was performed using the AllPrep DNA/RNA/miRNA Universal Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... viral nucleic acids (both RNA and DNA) were extracted with the QIAamp Viral RNA Minikit (Qiagen; CA).
-
bioRxiv - Developmental Biology 2023Quote: ... DNA from brain regions was extracted using an automated nucleic acid extraction platform called QIAcube HT (Qiagen) with a column-based extraction kit ...
-
bioRxiv - Cell Biology 2023Quote: ... The cleared lysate was then mixed with nickel-nitrilotriacetic acid (Ni-NTA)-agarose beads (QIAGEN, Hilden, Germany) or glutathione (GSH ...
-
bioRxiv - Cancer Biology 2023Quote: ... The diluted plasma was recovered and processed for cfDNA isolation by QIAmp Circulating Nucleic Acid kit (Qiagen) [16].
-
bioRxiv - Microbiology 2023Quote: ... and nuclease treated prior to viral nucleic acid extraction with the QIAamp viral RNA mini kit (Qiagen) (Chong et al. ...
-
bioRxiv - Genomics 2024Quote: ... Nucleic acid was extracted from the supernatant using a QIAamp Viral RNA Mini Kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions with modifications ...
-
bioRxiv - Molecular Biology 2023Quote: RNA was extracted from CaCo-2 cells infected with SARS-CoV-2 using the RNeasy Mini kit (Qiagen) including an in-column DnaseI treatment step ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 ml of the non-stressed culture was added to 2 ml of the RNAprotect Bacteria Reagent (Qiagen), vortexed and incubated for 5 min at room temperature ...
-
bioRxiv - Genomics 2019Quote: ... are prepared as follows: 4 µL of Vapor-Lock (Qiagen) is manually added to each well using a multichannel pipette followed by 2 µL of lysis buffer (0.2 µL of 25 µg/µL Qiagen Protease ...
-
bioRxiv - Pathology 2021Quote: ... RNA was extracted using RNeasy Mini Kit (Qiagen 741-4) per the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: ... and WNT signaling targets PCR array (Qiagen, PAMM 243ZE-4) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... and incubated with 4 mg/mL RNase A (Qiagen 158922) diluted 1:286 in 2X SSC for 30 min at 37 °C ...
-
bioRxiv - Cancer Biology 2020Quote: ... siRNAs were selected among FlexiTube GeneSolution 4 siRNA sets (Qiagen) and reordered after validation as dTdT-overhanging 19 nt RNA duplexes (Thermo) ...
-
bioRxiv - Microbiology 2020Quote: ... 4) Powersoil® Isolation kit (MO Bio Laboratories/Qiagen, Canada) by the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... and subsequently normalized to 4 nM using elution buffer (Qiagen) with 0.1% Tween20 (Sigma) ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 bead volumes of 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl 10X HotStar PCR buffer (Qiagen), 0.065 μl 5’ primer mix ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2% volume of proteinase K solution (Qiagen) was added ...
-
BCR analysis of single-sorted, putative IgE+ memory B cells in food allergy: an ephemeral existence?bioRxiv - Immunology 2019Quote: ... 2 μL of 0.1 M Dithiothreitol (Qiagen), 1 μL of 10 mM each dNTP ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’, Qiagen), si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... 12.5 nM Dvl2 siRNA #2 (Qiagen, #SI00063441) 5’-CACGCTAAACATGGAGAAGTA-3’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA) (Qiagen, Hs_PLCB1_6, SI02781184); PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA ...
-
bioRxiv - Immunology 2021Quote: ... added 2 ul of RNase A (Qiagen), and 2 ul of Proteinase K (RNA grade ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA #2: 5’-AGCGACTGAGCCGCTATAATA-3’ (SI04232011, Qiagen); #3 ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 volumes of RNA protect (Qiagen) were added ...
-
bioRxiv - Developmental Biology 2019Quote: RNA was extracted from pools of 6 × 105 FACS-isolated cells using the miRNeasy Micro Kit (Qiagen). Quantification of total RNA was performed by Qubit® RNA BR Assay kit (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were transfected in 10 cm2 or 6-well plates at ∼60% confluency using PolyFect (Qiagen 301107) and washed with complete media 6 h later.
-
bioRxiv - Plant Biology 2020Quote: ... Total RNA (at least 6 μg) was extracted using the RNeasy Plant Mini kit (Qiagen, Hilden, Germany), with an additional step to remove contaminating DNA ...
-
bioRxiv - Plant Biology 2020Quote: ... 6 and 48 HAT to ammonium or nitrate amended plates using RNeasy® Plant Mini kit (QIAGEN) according to the manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2022Quote: ... RNA was isolated from 5-6 replicated lung slices from each treatment using miRNeasy Mini Kit (Qiagen) at time 0 and time 120 hours for all groups ...
-
bioRxiv - Molecular Biology 2020Quote: SH-SY5Y cells plated in 6-well plates were lysed using 750ul of QIAzol Lysis reagent (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... GAS and SOL muscles from 6 mice per group were pulverized and lysed in RLT buffer (Qiagen) and treated with proteinase K (Qiagen ...
-
bioRxiv - Microbiology 2019Quote: ... qPCR cycles were run as described elsewhere 6 but using a Rotor Gene-Q instrument (QIAGEN, GER). To quantify the relative abundance of Cori and ter chromosomal regions in each sample ...