Labshake search
Citations for Qiagen :
101 - 150 of 2946 citations for 3 2 5 Dioxoimidazolidin 4 yl propanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Cleared lysate was briefly incubated (approximately 5 min) with 3 ml Ni-NTA Agarose (QIAGEN) before flow-through was collected ...
-
bioRxiv - Immunology 2022Quote: ... The supernatant was harvested at day 4 after transfection and incubated with Ni-nitrilotriacetic acid (Ni-NTA) agarose (Qiagen). The purification was carried out using gravity flow column and eluted with imidazole-containing buffer as previously described57,58 ...
-
bioRxiv - Developmental Biology 2022Quote: The total RNA of 3-4 organoids was extracted using the RNeasy Plus Micro Kit (Qiagen), followed by reverse transcription to generate cDNA with GoScript Reverse Transcription Kit (Promega) ...
-
bioRxiv - Genetics 2022Quote: ... Midi, 3-4 ml of blood) and Puregene (0.3-1 ml of blood, manual extraction) (Qiagen, Cat# 1057048 ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA was isolated (n = 3 or 4 mice per sample) using the RNeasy Mini Kit (QIAGEN), and aRNA was synthesized with Ambion’s MessageAmp aRNA Kit (Catalog # 1750 ...
-
bioRxiv - Plant Biology 2024Quote: ... 3-4 plants were pooled and RNA was extracted using the RNeasy plant mini kit (Qiagen). 100 ng of total RNA per sample determined using a Qubit fluorometer (Thermofisher) ...
-
bioRxiv - Genomics 2021Quote: ... cfDNA was isolated from 2 ml of plasma using either the manual QIAamp circulating nucleic acid kit (Qiagen), or the semi-automated QIAsymphony DSP Circulating DNA Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: ... The kidneys were homogenized using 0.5 M acetic acid and two 5-mm steel beads in TissueLyser LT (Qiagen), followed by addition of pepsin to 0.1 mg/ml and incubation for 3 days ...
-
bioRxiv - Neuroscience 2024Quote: ... Hybridization was performed at 66 °C overnight with 40 nM 5′ TYE-563-labelled locked nucleic acid (LNA)-(C4G2)2.5 probe (Exiqon Qiagen). Cells were then washed once in 2X SSC/0.1% Tween-20 for 5 minutes and three times in 0.1X SSC for 10 minutes at RT before being dehydrated as above and nuclei stained with DAPI.
-
bioRxiv - Biochemistry 2020Quote: ... The supernatant obtained after high speed centrifugation (20 000 x g for 30 min at 4 °C) was loaded on a gravity nickel-nitrilotriacetic acid (Ni-NTA) metal affinity column (Qiagen), washed with 10 column volumes (CV ...
-
bioRxiv - Genomics 2021Quote: ... cfDNA extraction was performed using the QIAamp Circulating Nucleic Acid Kit using the 4-mL plasma protocol (Qiagen, product #55114). Prior to DNA elution ...
-
bioRxiv - Cancer Biology 2020Quote: ... we utilized 4 mL of plasma and cfDNA was isolated using the QIAamp Circulating Nucleic Acid Kit (Qiagen, Hilden, Germany). The concentration of cfDNA was determined using the Qubit dsDNA High Sensitivity Assay Kit (ThermoFisher Scientific ...
-
bioRxiv - Biophysics 2020Quote: ... 45 min at 4 °C) and supernatant containing His-tagged proteins were purified by nickel-nitrilotriacetic acid (Ni-NTA) purification (Qiagen). Protein was eluted in a final elution buffer of 20 mM Tris pH 8.0 ...
-
bioRxiv - Biochemistry 2020Quote: ... and pJET_Luc_FL_UTR_REV (5’-GCAATGAAAATAAATGTTTTTTATTAGGCAGAATCCAAATGC-3’) primers and was purified with the QIAquick PCR Purification Kit (Qiagen) directly after the PCR reaction ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The obtained 5□- and 3□-RACE products were purified using a QIAquick Gel Extraction Kit (QIAGEN), subcloned into a pTAC-2 Vector (Bio Dynamics Laboratory lnc. ...
-
bioRxiv - Microbiology 2024Quote: ... and homogenized by bead-beating with 3 x 5 mm stainless steel beads (Qiagen, Hilden, Germany) in 1 ml sterile 1X PBS to produce internal fly-bacterial suspensions.
-
bioRxiv - Microbiology 2024Quote: 3-5 × 105 cells were harvested and total RNA was extracted using the RNeasy kit (Qiagen) employing on-column DNase treatment ...
-
bioRxiv - Pathology 2022Quote: ... with stainless steel beads (2×5 mm) using a TissueLyser (Qiagen, Germantown, MD) for three minutes at 25 r/s twice ...
-
bioRxiv - Microbiology 2020Quote: ... with 2 × 5 mm stainless steel beads using the TissueLyser (Qiagen, Hilden, Germany) for 3 minutes at 25 r/s twice ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 2–5 min with steel balls in a tissue lyser (Qiagen, Germany). Tissue lysates were incubated with the buffer at 4°C overnight (cell samples were incubated in lysis buffer for 30 min at 4°C) ...
-
bioRxiv - Biochemistry 2024Quote: ... incubated 2 hr with 5 mL of packed Ni-NTA agarose beads (Qiagen), filtered (0.45 µm Millex-HP PES membrane filter unit ...
-
bioRxiv - Plant Biology 2023Quote: ... RNA was extracted from 3-4 two-week old gemmae using the RNeasy Plant kit (#74903, Qiagen) with RLT buffer supplemented with beta-mercaptoethanol ...
-
bioRxiv - Microbiology 2020Quote: ... 2 mL of fermentor culture was added to 4 mL RNAprotect Bacteria Reagent (Qiagen) and immediately vortexed for 10 sec ...
-
bioRxiv - Bioengineering 2022Quote: ... 350 µL of NucleoSpin RNA extraction buffer along with 4-5 ceramic beads (Qiagen 13113) were added 14into the tube ...
-
bioRxiv - Plant Biology 2024Quote: ... 4-5 leaf pieces from clip-inoculated samples) using RNeasy Plant Mini Kit (Qiagen, Germany). Depending on the RNA concentration ...
-
bioRxiv - Developmental Biology 2021Quote: ... was performed using SYBR green based detection in a Biorad thermal cycler with MiRCURY LNA-based small RNA probes designed against 5’end of tRNA ArgCCT-2 (5‘GCCCCAGUGGCCUAAUGGAUAAGGCACUGGCC3’) with a polyA tail directed reverse miRCURY primer (Qiagen # 339317). U6 was used as an internal control (Qiagen # 339306).
-
bioRxiv - Molecular Biology 2021Quote: The ER-I-PpoI cells treated with 4-OHT (2.5 μM) for 1 hour were collected for extraction of the total nucleic acids using DNeasy Blood & Tissue Kits (Qiagen) or PureLink(tm ...
-
bioRxiv - Neuroscience 2021Quote: ... The frozen brain tissue blocks of WRM and BF were boiled for 8 min and homogenized in 5% acetic acid using a TissueLyser LT (Qiagen) for 6 min at 50 Hz ...
-
bioRxiv - Biophysics 2021Quote: ... Capture probes that contained locked nucleic acid (LNA) residues were purchased either from IDT with a 5′ Cy3 modification and HPLC purification or from Qiagen with a 5′ amino modification with HPLC purification ...
-
bioRxiv - Biophysics 2021Quote: cfDNA was isolated from 2 mL of plasma for each sample via the QIAamp Circulating Nucleic Acid kit (Qiagen). ddPCR was performed using the QX200 Droplet Digital PCR System (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2024Quote: ... cfDNA was isolated from 2 mL of serum using a QIAamp Circulating Nucleic Acid Extraction Kit (Qiagen, Hilden, Germany). The DNA was eluted twice through a column for purification ...
-
bioRxiv - Neuroscience 2021Quote: ... matching a sequence in intron 22 of the HTT gene (5’-TAATACGTAAGTGTCACAA-3’, custom synthesized by Qiagen) was delivered by intracerebroventricular (ICV ...
-
bioRxiv - Plant Biology 2020Quote: Total RNA was extracted from pools of 3-5 second leaves using the Plant RNAeasy kit (Qiagen) using manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... cells pooled from n = 3 - 5 mice / cohort) was isolated using the RNeasy Plus Mini Kit (Qiagen). Clariom S microarray analysis (Affymetrix ...
-
bioRxiv - Bioengineering 2024Quote: ... Tsg101 (Hs_TSG101_6) target sequence: 5′-CAG TTT ATC ATT CAA GTG TAA -3′ (QIAGEN, cat. no. SI02655184); Alix (Hs_PDCD6IP_5 ...
-
bioRxiv - Bioengineering 2024Quote: ... Alix (Hs_PDCD6IP_5) target sequence: 5′-AAG AGC TGT GTG TTG TTC AAT -3′ (QIAGEN, cat. no. SI02655345); Negative Control siRNA ...
-
bioRxiv - Plant Biology 2020Quote: Total DNA was isolated from 2-3 weeks old seedlings with DNeasy Plant Mini Kit (QIAGEN). 1ng of DNA per qPCR reaction was used as template ...
-
bioRxiv - Genetics 2020Quote: ... 4 dpe on-tet n=3) was extracted using the Qiagen RNeasy Mini Plus Kit (Qiagen, Hilden, Germany), which includes a column-based genomic DNA removal step ...
-
bioRxiv - Biochemistry 2023Quote: ... for 45 min at 4°C and the supernatant was mixed with 3 mL Ni-NTA agarose (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... for 45 min at 4°C and the supernatant was mixed with 3 mL Ni-NTA agarose (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Pathology 2023Quote: ... with 2 x 5 mm stainless steel beads using a TissueLyser (Qiagen, Germantown, MD) for 3 minutes at 25 r/s for 2 cycles ...
-
bioRxiv - Pathology 2022Quote: ... with 2 x 5 mm stainless steel beads using a TissueLyser (Qiagen, Germantown, MD) for 3 minutes at 25 r/s for 2 cycles ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4 μl of bisDNA was added to 2 μl 10x PCR buffer (Qiagen, Cat# 203203), 2 μl of 10 μM primer mix (Methods Table 1) ...
-
bioRxiv - Biophysics 2022Quote: ... the supernatant was incubated for 2 h at 4 °C with Ni2+-NTA-agarose (Qiagen) (20 mg of proteins/ml of resin ...
-
bioRxiv - Immunology 2021Quote: ... Skin samples were homogenized in a TissueLyser LT (Qiagen, 50 Hz, 2 times 4 minutes) using 5 mm stainless steel beads (Qiagen) ...
-
bioRxiv - Neuroscience 2023Quote: Total mRNA from 2 to 4 organoids were isolated using the RNeasy mini kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... 15 mM DTT) and then treated with 2 μL of 4 mg/mL Protease (QIAGEN) by incubation at 55°C for 6 hours ...
-
bioRxiv - Immunology 2024Quote: ... Nickel nitrilotriacetic acid (Qiagen) agarose beads were washed in TBS and added to filtered supernatant at a ratio of 2-3 mL resin/L and incubated on a rotator over-night at 4°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... additional DNA from 1-5 mL of plasma was extracted using the QIAamp® Circulating Nucleic Acid Kit (Qiagen, catalogue # 55114). Illumina sequencing libraries were constructed using SRSLY® PicoPlus DNA NGS Library Preparation Kit (ClaretBio – Cat ...
-
bioRxiv - Genomics 2020Quote: ... SARS-CoV-2 nucleic acids were isolated from 300 µl viral transport media using the QIAamp Viral RNA Mini kit (Qiagen) according to the manufacturer’s protocol ...