Labshake search
Citations for Qiagen :
51 - 100 of 2946 citations for 3 2 5 Dioxoimidazolidin 4 yl propanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... An A base was added to the 3’ ends with Klenow (3’-4’ exo-) (Qiagen). The processed ds-cDNA was then ligated to Illumina sequencing adapters with T4 DNA Ligase (Qiagen) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Amplification of cDNA for validation of doxycycline induction was performed with U2AF1 primers (forward: 5’-GGCACCGAGAAAGACAAAGT-3’; reverse: 5’-CTCTGGAAATGGGCTTCAAA-3’) and PCR products were purified using QIAquick PCR purification kit (QIAGEN, Cat #28104) before Sanger sequencing ...
-
bioRxiv - Microbiology 2020Quote: ... region was amplified using fungal-specific primers (60): ITS1F (5’-CTTGGTCATTTAGAGGAAGTAA-3’) and ITS4 (5’-TCCTCCGCTTATTGATATGC-3’) and the HotStarTaq Plus Master Kit (Qiagen, Valencia, CA). Amplicons from different samples were pooled to equimolar concentrations and purified of short fragments using Agencourt Ampure beads (Agencourt Bioscience Corporation ...
-
bioRxiv - Microbiology 2024Quote: ... and homogenized in groups of 3-5 flies by bead-beating with 3 x 5 mm stainless steel beads (Qiagen, Hilden, Germany) in 1 ml 1X PBS ...
-
bioRxiv - Microbiology 2022Quote: ... of the 16S rRNA gene that amplified via PCR using primers 338F (Seq: 5’-ACTYCTACGGRAGGCWGC-3’) and 1061R (Seq: 5’-CRRCACGAGCTGACGAC-3’) with the HotStar HiFidelity Polymerase Kit (catalog number 202602; QIAGEN, Hilden, Germany). Supplementary Figure 1 shows the 16S rRNA gene map and the primers used ...
-
bioRxiv - Neuroscience 2022Quote: ... or a non-targeting scrambled control (Scr; sequence: 5’-TAACACGTCTATACGCCCA-3; Qiagen, Cat No.: 339137; 0.1 nmol in 2 μL PBS), using a 2 μL Hamilton syringe at a rate of 1 μL/min ...
-
bioRxiv - Molecular Biology 2024Quote: ... the supernatant was incubated with 3 ml nickel- nitrilotriacetic acid Ni-NTA beads (Qiagen) preequilibrated with the same buffer overnight ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... or a 3:2 mixture of QG buffer (QIAGEN) and isopropanol ...
-
bioRxiv - Cancer Biology 2021Quote: ... a 19-mer SPRY2 target sequence (5′-AACACCAATGAGTACACAGAG-3) (QIAGEN) was used and for the control a 19-mer NSi control sequence (QIAGEN ...
-
bioRxiv - Cell Biology 2020Quote: ... For Astrin siRNA oligo #367 (5′-TCCCGACAAC TCACAGAGAAA -3′)(Qiagen) was used as described (Thein et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... The supernatant was incubated at 4 °C overnight with Ni2+-nitrilotriacetic acid resin (Qiagen) pre-equilibrated with buffer B ...
-
bioRxiv - Microbiology 2020Quote: ... CjNC110-LNA DIG-labeled probe (/5’DigN/ GCACATCAGTTTCAT/3’Dig_N/) (QIAGEN) was added to 15 mL DIG EasyHyb™ Buffer (Roche ...
-
bioRxiv - Systems Biology 2022Quote: ... 5 μl of proteinase K (approximately 3 U, Qiagen, cat. # 19131) were added and incubated for 1 h at 56°C ...
-
bioRxiv - Cell Biology 2021Quote: ... 5’-TAGCATTGTCAAGCTCCTAAA-3’ siRNAs or AllStars Negative Control siRNA (Qiagen, #1027281). After 72 h ...
-
bioRxiv - Cell Biology 2023Quote: ... using 30 nM Hs_LUZP1 siRNA (target sequence, 5′-CAGCGGGTGCTGAGAATTGAA-3′; QIAGEN) or 30 nM AllStars negative-control siRNA (QIAGEN) ...
-
bioRxiv - Cell Biology 2024Quote: ... HOXD11 (Qiagen, Sequence: 5′-TGC TAG CGA AGT CAG A-3′), HOXD13 (Qiagen ...
-
bioRxiv - Cell Biology 2024Quote: ... HOXD13 (Qiagen, Sequence: 5′-CAT CAG GAG ACA GTA T-3′), for 24hr and 48hr for RNA and protein extraction respectively ...
-
bioRxiv - Physiology 2022Quote: ... Fifteen milligrams of liver were homogenized in 200 µL of a 3:3:2 solution of acetonitrile:isopropanol:water (MeCN:IPA:H2O) in ceramic bead tubes (1.4 mm, Qiagen #13113-50) using a TissueLyzer II (Qiagen #85300) ...
-
bioRxiv - Genomics 2020Quote: ... purified nucleic acids were treated with 1-5 μl 1 mg/ml RNaseA (Qiagen) for 45 minutes at 37 °C to degrade RNA ...
-
bioRxiv - Microbiology 2022Quote: ... Supernatant was applied to a 5 ml nickel-nitrilotriacetic acid column (Qiagen, Valencia, CA) that had been equilibrated with buffer A at a rate of 1 ml/min ...
-
bioRxiv - Microbiology 2023Quote: ... and the supernatant was added to 3 ml of Ni-nitrilotriacetic acid (NTA) superflow resin (Qiagen) and the mixture was applied onto a gravity drip column ...
-
bioRxiv - Cancer Biology 2021Quote: ... cfDNA was extracted from approximately 4□ml of plasma (QIAamp Circulating Nucleic Acid kit, Qiagen) and then constructed into sequencing libraries with end repair ...
-
bioRxiv - Cell Biology 2021Quote: The siRNA sequence (5’-GAGUAGAACUAGAAUGUGA-3’) targeting Hec1 was synthesized by Qiagen. The ON-TARGETplus SMARTpool siRNA sequences (5’-GAACGAGUAACCACAAUUA-3’) ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were transfected using siRNAs targeting MAD2 sequence 5′-AGAUGGAUAUAUGCCACGCTT-3′ (Qiagen), pools of siRNAs targeting the TP53 sequence 5’-GAAAUUUGCGUGUGGAGUA-3’ ...
-
bioRxiv - Genomics 2021Quote: ... The scramble-miR miRCURY LNA Detection probe (5’-GTGTAACACGTCTATACGCCCA-3’, YD00699004, QIAGEN) was used as a negative control ...
-
bioRxiv - Genetics 2020Quote: ... The 3’ and 5’ – DIG labeled miRCURY LNA miRNA Detection probes (Qiagen, negative control Scramble-miR cat ...
-
bioRxiv - Cell Biology 2024Quote: ... or p300 (Qiagen, Sequence: 5′-TAG TCT GGT CCT TCG T-3′) for 24hr ...
-
bioRxiv - Genomics 2024Quote: ... 1 µL (50U) of high-concentration klenow 3’-5’ exo-polymerase (Qiagen) was added ...
-
bioRxiv - Genomics 2023Quote: Approximately 3-4 million cells were solubilized with 1 mL QIAzol (Qiagen, 79306) and 0.2 mL chloroform in 5PRIME Phase-Lock Gel heavy tubes (QuantaBio ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Genomics 2024Quote: ... RNA was first amplified using a first-round PCR (RdRp S1 5ߣ-GGKTGGGAYTAYCCKAARTG -3’, RdRp R1 5’-TGYTGTSWRCARAAYTCRTG-3’) with the One-Step RT-PCR Enzyme MixKit (Qiagen), targeting a total expected size of 620 base pairs (bp) ...
-
bioRxiv - Plant Biology 2020Quote: Total RNA isolated from 3-week-old thalli (QIAGEN RNAeasy Plant Kit 5) from each genotype was assessed for quality with a Nanodrop spectrophotometer and a Bioanalyzer 2100 microfluidics system (Agilent 6) ...
-
bioRxiv - Pathology 2021Quote: PDGFRα+ and CD56+ cells (passages 3 to 5) were lysed in Qiazol (Qiagen) followed by chloroform/isopropanol total RNA extraction ...
-
bioRxiv - Bioengineering 2021Quote: ... total cfDNA was extracted from 3 mL of separated plasma using the QIAamp Circulating Nucleic Acid kit (QIAGEN) following manufacturer instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... pools of 3 x 103 MPP1-4 were sorted directly into RLT buffer (Qiagen) enriched with 1% of β-mercaptoethanol ...
-
bioRxiv - Microbiology 2024Quote: ... 4 °C) and the supernatant was loaded onto a Ni-nitrilotriacetic acid (NTA) column (Qiagen, Hilden, Germany). After a washing step (6 M urea ...
-
bioRxiv - Neuroscience 2022Quote: ... Mice received either miRCURY LNA power inhibitor for mmu-miR-335-5p (Ant-335; sequence: 5’-CATTTTTCGTTATTGCTCTTG-3’; Qiagen, Cat No.: 339132; 0.1 nmol in 2 μL PBS), or a non-targeting scrambled control (Scr ...
-
bioRxiv - Neuroscience 2022Quote: ... and 18S rRNA (5’-GAG CGA AAG CAT TTG CCA AG-3’ and 5’-GGC ATC GTT TAT GGT CGG AA-3’) on a Roter-Gene Q (Qiagen, Hilden, Germany) with 2x AmpiGene® qPCR Green Mix Lo-ROX (Enzo Biochem ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA from patient material (n=3) and organoids (p1 and p2 n=3, p3 n=2) was extracted (RNeasy™ Mini Kit, Qiagen). To obtain cDNA ...
-
bioRxiv - Microbiology 2020Quote: ... in a 2 mL centrifuge tube for 3 min using a TissueLyzer (Qiagen). The obtained mixture was serially diluted in 5.0 mL sterile phosphate buffer and 150 µL aliquots of 10−4 to 10−7 dilutions were spread onto plates containing a range of media ...
-
bioRxiv - Cell Biology 2020Quote: ... phosphatase inhibitors 2 and 3) and then passing through Qiashredder columns (79656, Qiagen). Tissue samples were weighted ...
-
bioRxiv - Genomics 2024Quote: ... in a TissueLyser II apparatus (Qiagen Inc., USA; 2 × 3 min, 25 Hz). To remove phenol traces ...
-
bioRxiv - Genetics 2021Quote: ... 3×105 U2OS cells were reverse transfected with 5 pmol of each siRNA (QIAGEN) using lipofectamine RNAiMAX (Thermo Fisher ...
-
bioRxiv - Bioengineering 2024Quote: ... CHMP6 (Hs_CHMP6_1) target sequence: 5′-CTG AGC GCA ATC ACT CAG GAA -3′ (QIAGEN Sciences LLC ...
-
bioRxiv - Neuroscience 2024Quote: ... for 3 minutes with a 5 mm stainless steel ball (Qiagen, Cat. No. 69989). RNA was isolated using the Qiagen RNeasy Lipid Tissue Extraction Kit (Qiagen ...
-
bioRxiv - Genomics 2020Quote: Nucleic acids were isolated from 4 mL of plasma by using a QIAamp cfDNA/RNA kit (Qiagen 55184) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... Effectene (4 μL of enhancer and 5 μL of Effectene reagent; Qiagen 301427) was used to transfect 500 ng of the indicated eGFP plasmid ...
-
bioRxiv - Microbiology 2024Quote: ... Approximately 2-4 ml of cells were harvested at each timepoint and incubated with 2 volumes of RNAprotect (Qiagen) at room temperature for 5 minutes prior to centrifugation for 5 minutes at 4000xg 4°C ...
-
bioRxiv - Biophysics 2022Quote: ... The protein was eluted with 3C protease73 and subsequently incubated at 4°C for 2 h with 4 mL of Strep-tactin Superflow Plus beads (Qiagen) pre-equilibrated with buffer E ...
-
bioRxiv - Biophysics 2022Quote: ... The protein was eluted with 3C protease40 and subsequently incubated at 4°C for 2 h with 4 mL of Strep-tactin Superflow Plus beads (Qiagen) pre-equilibrated with buffer E ...