Labshake search
Citations for Qiagen :
1401 - 1450 of 2870 citations for 6 Bromo 4 5 dihydro 1H benzo b azepin 2 3H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... The control cells were replated after 5 days of AllStars negative-control siRNA (QIAGEN) treatment ...
-
bioRxiv - Immunology 2023Quote: Total mRNA was isolated from 5×105 cells using a kit (RNeasy kit, QIAGEN) and reverse-transcribed using oligo(dT)20 primer (SuperscriptIII ...
-
bioRxiv - Biochemistry 2023Quote: ... Lysate was batch bound to 5 mL of Ni-NTA Agarose (Qiagen, Cat# 30230) resin for 90 minutes stirring in a beaker at 4ºC ...
-
bioRxiv - Cell Biology 2024Quote: ... frozen samples were thawed in the presence of 5 volumes of TRI-reagent (Qiagen), pipette mixed thoroughly then centrifuged at 16,000 x g for 1 min ...
-
bioRxiv - Bioengineering 2024Quote: ... CHMP6 (Hs_CHMP6_1) target sequence: 5′-CTG AGC GCA ATC ACT CAG GAA -3′ (QIAGEN Sciences LLC ...
-
bioRxiv - Molecular Biology 2024Quote: ... The cleared supernatant was loaded onto a 5 mL Strep-Tactin Superflow Cartridge (Qiagen) at 1 mL/min ...
-
bioRxiv - Microbiology 2024Quote: ... The supernatant was loading onto 5 mL Ni-NTA resin (Qiagen, catalog number 30230) equilibrated with buffer A (PBS ...
-
bioRxiv - Neuroscience 2024Quote: ... for 3 minutes with a 5 mm stainless steel ball (Qiagen, Cat. No. 69989). RNA was isolated using the Qiagen RNeasy Lipid Tissue Extraction Kit (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was isolated from 4 mL of culture using the miRNAeasy Mini Kit (Qiagen, Hilden, Germany) and Qiazol lysis reagent ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The concentration of purified RNA was measured using a Qubit 4 fluorometer (QIAGEN K.K., Tokyo, Japan) with Qubit RNA BR Assay kits (QIAGEN K.K. ...
-
bioRxiv - Developmental Biology 2022Quote: The total RNA of 3-4 organoids was extracted using the RNeasy Plus Micro Kit (Qiagen), followed by reverse transcription to generate cDNA with GoScript Reverse Transcription Kit (Promega) ...
-
bioRxiv - Neuroscience 2020Quote: ... 6b and 6d and the Supplemental Figure 4 we used the RNAeasy Minikit (Qiagen; Cat#74104) following the manufacturer’s instruction.
-
bioRxiv - Cancer Biology 2020Quote: ... then spun at 14000K RPM for 10 minutes at 4°C to pellet debris (Qiagen, 37901). Protein concentration in the supernatant was quantified using BCA assay (Thermo Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... 4°C) and total RNA was extracted from the supernatant using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: Total hippocampus RNA was isolated from 4-month olds rats using RNeasy Lipid Tissue Kit (Qiagen) as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... followed by addition of 4 μg pBABE-hygro-hTERT prepared by maxiprep (Qiagen Canada, Mississauga, ON), to a final volume of 200 μl ...
-
bioRxiv - Genetics 2022Quote: ... Midi, 3-4 ml of blood) and Puregene (0.3-1 ml of blood, manual extraction) (Qiagen, Cat# 1057048 ...
-
bioRxiv - Bioengineering 2020Quote: ... Each well is then diluted with 1 to 4 v:v in RNAse free elution buffer (QIAgen) to a total volume of 8 µL ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... total RNA was harvested from BMDM 4 hours post-treatment per Qiagen RNA extraction protocol (QIAGEN). RNA was then reverse transcribed to cDNA using iScript Kit (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4°C) and supernatant was transferred to tubes containing 30µl precleared Ni-NTA agarose beads (Qiagen) in the presence of 0.05% Tween-20 and 15mM imidazole ...
-
bioRxiv - Developmental Biology 2020Quote: ... the rest of the embryo was fixed in 4% paraformaldehyde/PBS and stained with DAPI (Qiagen) for easy visualization of the somites under a microscope and characterization of the embryonic stage ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The concentration of purified RNA was measured using a Qubit 4 fluorometer (QIAGEN K.K., Tokyo, Japan) with Qubit RNA BR Assay kits (QIAGEN K.K. ...
-
bioRxiv - Microbiology 2020Quote: ... Cell pellets were recovered (5000g, 15 min at 4 0C) and lysed in QIAzol reagent (Qiagen). Total RNA was isolated using the RNeasy mini kit (Qiagen ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA was isolated (n = 3 or 4 mice per sample) using the RNeasy Mini Kit (QIAGEN), and aRNA was synthesized with Ambion’s MessageAmp aRNA Kit (Catalog # 1750 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µL of 10 mg/mL RNase A (DNeasy Blood &Tissue kit, #69504, Qiagen, Hilden, Germany) was added to each sample and incubated at 37°C for 2 h ...
-
bioRxiv - Plant Biology 2022Quote: ... 100mg of roots of 4-day-old seedlings according to the RNeasy Plant Mini Kit (Qiagen). cDNA was synthesized from 1µg of total mRNA using the QuantiNova Reverse Transcription Kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted from cultures using a DNeasy UltraClean 96 Microbial Kit (Qiagen, Cat. #10196-4). The 16S gene was amplified using primers 5’AGAGTTTGATCCTGGCTCAG and 5’GACGGGCGGTGWGTRCA ...
-
bioRxiv - Molecular Biology 2022Quote: ... Further these lysates were incubated overnight at 4°C with prewashed Ni-NTA beads (Qiagen, 30210).Sequential washes with wash buffer 1-4 ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from cultures using the DNeasy UltraClean 96 Microbial Kit (Qiagen, Cat. #10196-4). The bacterial 16S rRNA variable region 4 (V4 ...
-
bioRxiv - Immunology 2023Quote: RPMs (4 × 105 cells) were harvested and total RNA was extracted with RNeasy micro kit (QIAGEN). RNA libraries were prepared using TruSeq stranded mRNA Library Prep Kit (Illumina) ...
-
bioRxiv - Biochemistry 2023Quote: ... 4 OD600 of cells were harvested and RNA was extracted using the RNeasy Mini Kit (Qiagen) in conjunction with the RNase-Free DNase Set (Qiagen ...
-
bioRxiv - Cancer Biology 2023Quote: ... For MdmX knockdown cells were transfected with FlexiTube siRNA Mdm4 (cat.#SI00037163, siMdmX#4) from QIAGEN or costume siRNA against MdmX (siMdmX#1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Plugs were allowed to solidify at 4°C and were then incubated with Proteinase K (QIAGEN) (1 h at 50°C and then overnight at 37°C) ...
-
bioRxiv - Plant Biology 2024Quote: ... DNA extractions were performed with the MagAttract PowerSoil DNA kit (Qiagen, Cat. No. 27000-4-KF) optimized for the KingFisher™ Flex Purification System (Thermo Scientific ...
-
bioRxiv - Developmental Biology 2024Quote: ... total RNA was isolated from E17.5 hearts (n = 4/genotype) using a RNeasy Micro Kit (Qiagen). NanoString processing was completed by the Emory Integrated Genomics Core ...
-
bioRxiv - Plant Biology 2024Quote: ... 3-4 plants were pooled and RNA was extracted using the RNeasy plant mini kit (Qiagen). 100 ng of total RNA per sample determined using a Qubit fluorometer (Thermofisher) ...
-
bioRxiv - Immunology 2019Quote: ... the 250 genes comprising the signature of time since exposure to an active TB case (6 months vs. baseline) were analyzed using canonical pathway analysis with QIAGEN’s Ingenuity® Pathway Analysis platform (IPA®, QIAGEN Redwood City, www.qiagen.com/ingenuity). To compare transcriptional modules that were concordantly or discordantly regulated between mice ...
-
bioRxiv - Cell Biology 2022Quote: ... After 72 h cells were passaged onto new 6-well plates and culturing continued for an additional 72 h after which cells were harvested in Buffer RLT (Qiagen; for RNA-sequencing, RT-qPCR) or used for cell culture experiments.
-
bioRxiv - Cell Biology 2023Quote: ... RNA and protein were digested in 40 mM Tris-HCl pH 6 and 10 mM EDTA by adding first RNAse A (Qiagen; #19101, 1.5 hours, 37°C), followed by Proteinase K (Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2019Quote: ... DNA was extracted from 5 µL of RBCs using the Gentra Puregene Tissue Kit (Qiagen) and kept frozen at −80°C until analysis ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and homogenized with 5 mm stainless steel beads on a Tissue Lyzer II (Qiagen 85300) at 30 Hz for 30 minutes ...
-
bioRxiv - Molecular Biology 2019Quote: 5 µg of RNA of was cleaned up using using RNeasy mini prep column (Qiagen), according to manufacturer’s instructions ...
-
Persistent DNA damage rewires lipid metabolism and promotes histone hyperacetylation via MYS-1/Tip60bioRxiv - Cell Biology 2021Quote: ... The worms were homogenized with a 5□mm steel bead using a TissueLyser II (Qiagen) for 2□×□2.5□min at a frequency of 30 times/sec ...
-
bioRxiv - Neuroscience 2020Quote: ... Powdered tissue (∼5 mg) was dissolved in lysis buffer provided by RNeasy micro kit (Qiagen), supplemented with 1% (v/v ...
-
bioRxiv - Synthetic Biology 2021Quote: ... for 5 mins and then neutralized by addition of Qiagen N3 neutralization buffer (Qiagen, 19053). Subsequently ...
-
bioRxiv - Physiology 2022Quote: ... Samples were homogenized using a TissueLyser II device (Qiagen; 5 min at 30 pulses/second) in 425 μL water ...
-
bioRxiv - Microbiology 2021Quote: Genomic DNA was extracted from 5 × 106 cells using Qiagen DNeasy Blood & Tissue Kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... phagocytosed by sorting cells into a 96 well plate containing 5 ul of RLT (Qiagen) + 1%β-Mercaptoethanol (Sigma).
-
bioRxiv - Molecular Biology 2020Quote: ... whole worms were homogenized with a 5 mm steel bead using a TissueLyser II (QIAGEN) for 5 min at frequency of 30 times/second ...
-
bioRxiv - Biochemistry 2020Quote: ... the eluted fraction was subsequently passed through a 5 ml Ni-NTA Superflow cartridge (Qiagen). The column was washed with 10 CV Ni-NTA Wash Buffer 1 (PBS ...