Labshake search
Citations for Qiagen :
1251 - 1300 of 2870 citations for 6 Bromo 4 5 dihydro 1H benzo b azepin 2 3H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... Supernatant was mixed with 2 mL of Ni-NTA agarose (Qiagen) on a rotary shaker for 1 h at 4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... and finally eluted in 2 x 30 μL EB Buffer (Qiagen) at 60°C.
-
bioRxiv - Genomics 2020Quote: ... or (ii) QIAseq SARS-CoV-2 Primer Panel (Qiagen GmbH, Germany) for amplified of viral genome sequencing or (iii ...
-
bioRxiv - Biochemistry 2021Quote: ... and then stirred with 2 ml Ni-NTA Superflow resin (Qiagen) that had been pre-equilibrated with Buffer A for 10 min on ice ...
-
bioRxiv - Systems Biology 2020Quote: ... Samples were collected into 2 ml round bottom microcentrifuge tubes (Qiagen) and weighed prior to freezing ...
-
bioRxiv - Cell Biology 2021Quote: ... Cleared lysate was incubated with 2 mL Ni-NTA agarose (Qiagen) for 1 hr and washed with 50 mL wash buffer (1X PNI ...
-
bioRxiv - Immunology 2022Quote: ... 2 μg/ml TPCK-trypsin) using a Tissue Lyser II (Qiagen) with the following program ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This mixture was diluted a further 2× into an Omniscript (Qiagen) RT reaction following the manufacturer’s instructions and incubated at 50°C for 20 min followed by heat inactivation at 95°C for 2 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eIF3B – C 2: GACCGACTTGAGAAACTCAAA) were synthesized by QIAGEN (Hilden, Germany). For transfection ...
-
bioRxiv - Microbiology 2023Quote: EHEC cultures were mixed with 2 volumes of RNAprotect reagent (Qiagen), incubated at room temperature for 5 minutes and harvested by centrifugation ...
-
bioRxiv - Microbiology 2024Quote: ... using a 2 ml Tube Holder Set (QIAGEN; Cat. No. 11993), and DNA extractions were eluted with C6 Elution Buffer in a final volume of 80 µl ...
-
bioRxiv - Microbiology 2024Quote: ... The columns were put on new 2 mL collection tubes (Qiagen) and centrifuged at 15000 rpm for 1 min to dry the columns ...
-
bioRxiv - Microbiology 2024Quote: ... cleared lysates were incubated with 2 mL Ni-NTA agarose (Qiagen) on a rotator for 1 hour at 4°C ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was mixed with 2 ml Ni-NTA agarose (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cleared lysates were incubated with 2-4ml nickel NTA beads (Qiagen) for 20-40 minutes before washing beads with 5-10 column volumes of lysis buffer ...
-
bioRxiv - Immunology 2023Quote: ... starting from step 2 of the RNeasy micro kit (Qiagen, #74004) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: Total RNA isolated from 3-week-old thalli (QIAGEN RNAeasy Plant Kit 5) from each genotype was assessed for quality with a Nanodrop spectrophotometer and a Bioanalyzer 2100 microfluidics system (Agilent 6) ...
-
bioRxiv - Microbiology 2021Quote: ... was modified by a custom-added biotin residue at its 5’-end (Qiagen). Hybrids of the CoV-2 RNAs with the probe were detected with a goat anti-biotin antibody conjugated to 10 nm gold particles (BBI international).
-
bioRxiv - Cell Biology 2020Quote: ... mRNA samples were concentrated to ≤ 5 µl by MinElute column (QIAGEN, Cat. 74204). For generation of RNA-seq libraries ...
-
bioRxiv - Cell Biology 2019Quote: ... KIF4A siRNA 5’-CAGGTCCAGACTACTACTC-3’ against the 3’-UTR was obtained from QIAgen, and an optimised siRNA pool for KIF22 (KID ...
-
bioRxiv - Immunology 2019Quote: ... Expressed proteins were subsequently purified by Ni-chelate chromatography (Qiagen, 5 ml column) and SEC (S75 ...
-
bioRxiv - Biochemistry 2019Quote: ... The filtered supernatant was loaded onto a Ni2+ -chromatography column (5 ml, Qiagen) and washed in 20 CV buffer (50 mM Tris ...
-
bioRxiv - Immunology 2021Quote: RNA was isolated from ~5 x 105 cells using RNeasy mini kits (Qiagen), typically yielding 100-400 ng RNA ...
-
bioRxiv - Plant Biology 2021Quote: ... Samples were homogenized using 5 mm steel beads and a Tissuelyser II (Qiagen) operated at 30 Hz for 5 min ...
-
bioRxiv - Pathology 2021Quote: PDGFRα+ and CD56+ cells (passages 3 to 5) were lysed in Qiazol (Qiagen) followed by chloroform/isopropanol total RNA extraction ...
-
bioRxiv - Immunology 2020Quote: ... 5 U/ml dispase (Stemcell) and 50 mg/ml DNase I mix (Qiagen) in complete RPMI1640 medium ...
-
bioRxiv - Molecular Biology 2021Quote: ... genomic DNA was isolated from 5 million cells using the DNAeasy kit (Qiagen). 4ug gDNA was digested with NlaIII or MseI ...
-
bioRxiv - Cell Biology 2020Quote: ... 20 μl of 10% SDS and 5 ul of Proteinase K (Qiagen #19131) were added to each sample ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 10x CoralLoad PCR buffer and 5 µl of TopTaq Master Mix 2x (Qiagen). An initial denaturation cycle of 94°C for 6 min was followed by 35 cycles of 94°C for 45 s ...
-
bioRxiv - Biochemistry 2022Quote: ... The cleared lysate was applied to a 5 mL Ni-NTA cartridge (Qiagen) and the column was washed in two steps with lysis buffer supplemented with 25 and 50 mM imidazole ...
-
bioRxiv - Physiology 2022Quote: ... mRNA samples were concentrated to ≤ 5 µl by MinElute column (QIAGEN, Cat. 74204). For generation of RNA-seq libraries ...
-
bioRxiv - Microbiology 2022Quote: ... The cleared lysate was applied to a 5 mL Ni-NTA cartridge (Qiagen). The column was washed with 3 column volumes of lysis buffer and proteins were eluted stepwise with lysis buffer supplemented with 50 and 250 mM of imidazole ...
-
bioRxiv - Microbiology 2022Quote: ... The cleavage products were passed through a 5 mL Ni-NTA cartridge (Qiagen) and the column was washed with 5 column volumes of lysis buffer supplemented with 50 mM imidazole to remove the cleaved tag and the TEV protease ...
-
bioRxiv - Cell Biology 2020Quote: ... 20 μl of 10% SDS and 5 ul of Proteinase K (Qiagen #19131) were added to each sample ...
-
bioRxiv - Biophysics 2020Quote: ... This periplasmic extract was then incubated with 5 ml Ni-NTA beads (Qiagen) at 4°C for 15 minutes and the resin slurry was packed on an open chromatography column ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Protein was isolated from the lysate using 5 mL Ni-NTA resin (Qiagen) pre-equilibrated with lysis buffer and then washed with 15 column volumes (CV ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 5mM EDTA (pH 8) together with a 5 mm stainless steel bead (Qiagen) and macerated at 1,200 rpm for 2 mins in the Geno/grinder followed by a 10-minute centrifugation (17,000 x g ...
-
bioRxiv - Immunology 2019Quote: ... total RNA (5 mice per group) was extracted using RNeasy Micro Kit (QIAGEN). Samples were sent to Admera Health for sequencing and analysis ...
-
bioRxiv - Zoology 2021Quote: ... 0.1 μL of 5 U/μL Taq DNA Polymerase (QIAGEN, Valencia, CA, USA), 0.2 μL of U19 fluorescent dye ...
-
bioRxiv - Immunology 2020Quote: ... miRNA inhibitors (miRCURY LNA miRNA power inhibitor with or without 5’-FAM, Qiagen) were added directly to culture media at the time of activation and were taken up by the cells by spontaneous translocation across the cell membrane ...
-
bioRxiv - Pathology 2019Quote: ... with sterile 5 mm stainless steel beads and processed using Tissuelyzer LT (Qiagen). The homogenate was lyzed with proteinase K and subjected to DNA extraction using the QIAmp DNA mini kit (Qiagen) ...
-
bioRxiv - Biochemistry 2021Quote: ... The supernatant was applied to three 5 ml Ni-NTA Superflow cartridges (Qiagen). The resin was washed with 20 mM HEPES pH 8.0 ...
-
bioRxiv - Biochemistry 2021Quote: ... The sample was applied to a 5 ml Ni-NTA Superflow cartridge (Qiagen) in order to remove the uncleaved fusion protein and His6-TEV protease ...
-
bioRxiv - Biochemistry 2021Quote: ... The cleared lysate was applied to a 5 mL Ni-NTA cartridge (Qiagen) and the column was washed in two steps with lysis buffer supplemented with 25 and 50 mM imidazole ...
-
bioRxiv - Genetics 2021Quote: ... The supernatant was treated for 5 minutes at room temperature with RNAse (Qiagen) and then centrifuged again ...
-
bioRxiv - Bioengineering 2021Quote: ... total RNA was extracted from 5 organoids using the RNeasy Plus MiniKit (Qiagen). Purity was determined byA260–A280 ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was extracted from 5 ml samples using the miRNAeasy mini kit (Qiagen), treated with TURBO DNase (Ambion ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µg/mL DNase I (AppliChem) and 200 µg/mL RNase A (Qiagen) using 4 cycles of 15 s sonification at 30% duty cycle and 30% output control ...
-
bioRxiv - Molecular Biology 2024Quote: ... The dialysate was loaded onto 5 ml Ni2+-NTA column (Qiagen, Valencia, CA). After washing the column with buffer A containing 20 mM imidazole ...