Labshake search
Citations for Qiagen :
1351 - 1400 of 2378 citations for 6H 5 Oxa 1 2a 4a triazacyclopenta cd pentalene 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... 50 mg tumor tissue was mechanically homogenized in 1 ml Qiazol (Qiagen, Hilden, Germany), whereas cells were lysed in 1 ml Qiazol by resuspending ...
-
bioRxiv - Cell Biology 2022Quote: Reverse transcription was carried out using the miRCURY LNA™1 RT Kit (Qiagen) using 10 ng of RNA according to manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2022Quote: Total RNA was isolated from 1 million cells using the RNeasy Mini kit (Qiagen), according to the manufacturers’ protocols ...
-
bioRxiv - Microbiology 2023Quote: ... and a 1 kb band was purified using the Qiaquick Gel Extraction Kit (Qiagen) and cloned into pCR2.1 TOPO cloning vector ...
-
bioRxiv - Plant Biology 2023Quote: ... per 1 ml buffer RLC and on-column Dnase digestion with Dnase I (Qiagen). First-strand cDNA was synthesized from 1 μg of total RNA using a Thermo Scientific RevertAid RT Kit (Thermo Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... After incubation with the primary antibody from QIAGEN (Penta-His Antibody, 1:1000 dilution) at RT for 1 h under shaking ...
-
bioRxiv - Neuroscience 2024Quote: ... RT-PCR was normalized using the housekeeping genes hypoxanthine phosphoribosyl-transferase 1 (HPRT1, Qiagen QuantiTect Primer Assay ...
-
bioRxiv - Systems Biology 2024Quote: ... Following a 2-hour RNase A treatment (Qiagen, 100 mg/ml, 1:1,000 dilution) at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: RNA was isolated from RPE-1 cells using the RNeasy mini kit (Qiagen, CA) and cDNA was generated using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems ...
-
bioRxiv - Genomics 2024Quote: ... 500 µl liquid culture were mixed well with 1 ml RNAprotect Bacteria Reagent (Qiagen) and incubated for 5 min ...
-
bioRxiv - Biophysics 2023Quote: ... The supernatant was then incubated with 1 mL of Ni-NTA beads (Qiagen, USA) while rotating for 2 h at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 μg mRNA per sample was used to perform reverse transcription (Qiagen, Cat. # 205311). Gene expression levels were then detected using SYBR Green (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2022Quote: ... three kits were used: (1) Qiagen DNeasy Blood & Tissue Kits (Qiagen, cat. no. 69504) for DNA extraction and (2 ...
-
bioRxiv - Bioengineering 2023Quote: ... Total RNA was collected and purified using the RNeasy Mini Kit Part 1 (Qiagen). The total RNA concentration was quantified using a Nanodrop spectrophotometer ...
-
bioRxiv - Biophysics 2023Quote: ... The supernatant was then incubated with 1 mL of Ni-NTA beads (Qiagen, USA) while rotating for 2 h at 4°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... 15 µl of siRNA (1 µM, FlexiTube GeneSolution, Qiagen, Hilden, Germany, see Table S1) were diluted in 1.5 ml culture medium without supplements ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Genomic DNA was extracted from 1 mL of culture (DNeasy Blood & Tissue Kit; Qiagen) and quantified on a Nanodrop ...
-
bioRxiv - Biochemistry 2023Quote: ... cDNA was prepared from 1 µg of RNA using QuantiNova Reverse Transcription Kit (Qiagen). SYBR Green I Master (Roche ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was then incubated with 1 mL of Ni-NTA beads (Qiagen, USA) while rotating for 2 h at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... and pre-hybridized for 1 hour at 65 degrees in 1X ISH buffer (Qiagen). Digoxigenin-labeled LNA probes against mito-tRNA Asn and nuclear-encoded tRNA Asn designed by Qiagen (sequences in supplementary methods ...
-
bioRxiv - Pathology 2024Quote: ... was used to transfect HMEC-1 with siRNA control or siRNA MC1R oligonucleotides (Qiagen) (20 nM final concentration).
-
bioRxiv - Cancer Biology 2024Quote: ... Total RNA (1 μg) was reverse transcribed using the Quantitect Reverse Transcription Kit (Qiagen). Subsequently ...
-
bioRxiv - Cell Biology 2024Quote: ... Reverse transcription of 1 μg RNA was performed using Omniscript RT kit (Qiagen, #205111). CLN3 transcript was amplified ...
-
bioRxiv - Immunology 2024Quote: ... ∼1000 macrophages were sorted into 75µL of RLT buffer (Qiagen, containing 1% beta-mercaptoethanol), vortexed for 1 min and immediately frozen (−80°C) ...
-
bioRxiv - Molecular Biology 2024Quote: Total RNA was isolated from 1 × 106 cells using RNeasy Plus Mini Kit (Qiagen) with genomic DNA removal ...
-
bioRxiv - Microbiology 2024Quote: ... Planktonic cells (∼2x109 CFU) were mixed with a 2:1 volume of RNAprotect (Qiagen), pelleted ...
-
bioRxiv - Microbiology 2024Quote: ... and the pellet was resuspended in 1 ml of RNA protect bacteria reagent (Qiagen). Then ...
-
bioRxiv - Microbiology 2020Quote: ... Total DNA was extracted from 1 ml liquid samples using DNeasy Blood & Tissue kit (Qiagen). The variable ends of subtype II-C and type VI-B loci (C1 and C2 ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Genomics 2020Quote: Total RNA was extracted from 1–2 million cells using the AllPrep Mini kit (QIAGEN) according to the manufacturer’s instructions and 1 μg of total RNA was used to prepare each RNA-seq library ...
-
bioRxiv - Microbiology 2021Quote: ... The qPCR reaction mixture (10 μL) comprised 1× Rotor-Gene SYBR green PCR mix (Qiagen), 500 nM of each primer ...
-
bioRxiv - Genomics 2020Quote: RNA was purified from approximately 1 × 107 CHM13 cells using an RNeasy kit (Qiagen; 74104) and prepared into Iso-Seq libraries following a standard protocol68 ...
-
bioRxiv - Genomics 2020Quote: ... S2 cells were transfected with 1 ug plasmid DNA using the Effectene reagent kit (Qiagen). The plasmid DNA which contains cDNA of FLAG-tagged ECDs are under the metallothionein promoter control ...
-
bioRxiv - Molecular Biology 2021Quote: ... Unbound Biotin-HPDP was removed by chloroform/isoamylalcohol (24:1) extraction in MaXtract tubes (Qiagen). RNA was precipitated with 10th volume of 5M NaCl and 1 volume of isopropanol ...
-
bioRxiv - Molecular Biology 2021Quote: ... The backbone was extracted from a 1% agarose gel using QIAquick Gel Extraction Kit (Qiagen) and the minigene insert was cleaned up using QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Biophysics 2019Quote: ... proteins were purified by batch Ni-NTA bead purification (1 mL slurry/1L culture; Qiagen) and further purified by a Superdex 200 16/60 column (GE Healthcare ...
-
bioRxiv - Cancer Biology 2019Quote: ... following the manufacturer’s instructions and treated twice with DNase I (1 unit/µg RNA, Qiagen). The RNA concentration was quantified using nanodrop2000 (Thermo Fisher ...
-
bioRxiv - Plant Biology 2019Quote: ... with 1 min shaking at 25 Hz in the Tissue Lyser II (Qiagen, Hilden, Germany). Ground tissue was stored at −80 °C ...
-
bioRxiv - Genetics 2019Quote: ... DNA from FFPE sample 6005-1 was extracted using QIAamp DNA FFPE Tissue Kit (Qiagen). Genomic DNA and RNA were extracted from peripheral blood leukocytes from patient 6003 and from a non-HHT control individual using the Gentra PureGene Blood Kit (Qiagen ...
-
bioRxiv - Genomics 2020Quote: ... The supernatant of cell lysate was incubated with 1 mL Ni-NTA agarose beads (QIAGEN) at 4 °C for 1 h ...
-
bioRxiv - Genomics 2019Quote: ... cfDNA was extracted from 1 or 4 ml of urine according to manufacturer recommendations (Qiagen Circulating Nucleic Acid Kit ...
-
bioRxiv - Immunology 2019Quote: ... Purified RNA (1 μg) was reverse-transcribed to cDNA using RT2 First Strand Kit (Qiagen, Hilden ...
-
bioRxiv - Cell Biology 2019Quote: ... Co-NTA beads were obtained from stripping 1 mL of Ni-NTA resin from Qiagen in a Bio-rad gravity column with 50 mL of 0.5M EDTA (pH 8.0) ...
-
bioRxiv - Bioengineering 2020Quote: Genomic DNA was isolated from 1×106 tumor cells using DNeasy Blood & Tissue Kit (Qiagen). BCMA and CS1 loci amplicons ...
-
bioRxiv - Neuroscience 2020Quote: ... then converted to cDNA using 1 µg RNA and a QuantiTect Reverse Transcription kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... MCD360-1 and the F1 progenies using the DNeasy Plant Mini Kit (Qiagen, Valencia, CA). Equal amounts of DNA were pooled from 30 responsive as well as 30 non-responsive progenies for the INF1 recognition phenotype and 29 responsive and 30 non-responsive individuals for the SCR74 response phenotype ...
-
bioRxiv - Biochemistry 2021Quote: ... and the membrane suspension was mixed with 1 ml of Ni-NTA Superflow resin (Qiagen) per 1mg of GFP–His8 and incubated for 3 hours at 4 °C ...
-
bioRxiv - Bioengineering 2021Quote: RNA was extracted from ∼1 M cells using the QIAGEN RNeasy Mini Kit (QIAGEN 74104). A total of 36 samples were prepared ...
-
bioRxiv - Neuroscience 2020Quote: ... with all primers listed in Supplementary Table 1 and then purified (QIAGEN, PCR purification kit). Before nick translation ...
-
bioRxiv - Cell Biology 2021Quote: ... 4 °C) and the supernatant was then loaded onto 1 ml HisTrap HP column (Qiagen) at 4 °C ...