Labshake search
Citations for Qiagen :
1251 - 1300 of 3031 citations for 6 1 Aminoethyl 2H 1 4 benzoxazin 3 4H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: mRNA analyses were performed by extracting total mRNA from HEPA1-6 cells using RNeasy mini kit (Qiagen, 74104) following manufacturer instructions ...
-
bioRxiv - Neuroscience 2019Quote: Total RNA was extracted from ten pooled larval fish or one dissected adult brain per sample (RNeasy mini Kit; Qiagen, Valencia, CA, USA) for quantitative RT-PCR (qRT-PCR) ...
-
bioRxiv - Plant Biology 2020Quote: Leaf tissue from one of the sampled individuals per accession was used for DNA extraction using the Qiagen DNeasy kit (Qiagen, Valencia, CA, USA). Integrity of DNA was verified as a single high molecular weight band on a 1% agarose gel ...
-
bioRxiv - Microbiology 2022Quote: ... Total extracted RNA was resuspended in nuclease free water and one microgram was used for cDNA synthesis using the Quantitect reverse transcription kit (Qiagen, Germantown, MD, USA) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Then midguts were transferred on ice into a 2 ml microtube containing 200 µL of PBS1x with anti-proteases and crushed one minute at 30Hz with a Tissue Lyser (Qiagen, Tissue Lyser LT).
-
bioRxiv - Genomics 2019Quote: ... Total genomic DNA was extracted between one and five times using either the Qiagen DNeasy Blood and Tissue Kit (Qiagen, Cat. No. 69504) or the QuickGene DNA Whole Blood or Tissue Kit (Kurabo Industries) ...
-
bioRxiv - Cancer Biology 2019Quote: Total genomic DNA was extracted from 14 BRCA+ tumor samples from 13 patients (DNA was extracted from both breasts for one patient) using AllPrep DNA/RNA Mini Kit (Qiagen, Cat. No 80204). The matched control DNA was also isolated from blood of the same patients using Gentra Puregene Blood Kit (Qiagen ...
-
bioRxiv - Genetics 2020Quote: ... approximately 30 seeds per genotype were placed in a 2 mL Eppendorf Safe Lock tube along with one stainless steel bead (Qiagen Cat. No. 69989), frozen in liquid nitrogen ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... DNA was extracted in a pooled reaction (up to 10 wasps from one brood per reaction) using the Qiagen DNAeasy blood & tissue kit (QIAGEN Inc, Hilden, Germany). After extraction DNA was amplified in a multiplex PCR reaction using fluorescently labelled Lysi07 primers ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Total genomic DNA was extracted between one and five times per sample using the DNeasy Blood and Tissue Kit (Qiagen, Cat. No. 69504). Elutions were pooled and concentrated in an Eppendorf Concentrator Plus at 45°C and 1400 rpm until roughly 50 µl remained ...
-
bioRxiv - Microbiology 2023Quote: ... Primers and probe targeting the AIV matrix gene 36 were used to perform the quantitative RT-PCR (qRT-PCR) reaction by using the One-Step RT-PCR Kit (QIAGEN, Valencia, CA, USA) on a StepOne Real-time PCR System (Applied Biosystems ...
-
bioRxiv - Cell Biology 2023Quote: RNA was extracted from the hearts of either one-week old or three-week old female flies using the miRNeasy Mini Kit (QIAGEN, Germantown, MD, USA) as per manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... Total DNA was extracted from 1 ml liquid samples using DNeasy Blood & Tissue kit (Qiagen). The variable ends of subtype II-C and type VI-B loci (C1 and C2 ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Genomics 2020Quote: Total RNA was extracted from 1–2 million cells using the AllPrep Mini kit (QIAGEN) according to the manufacturer’s instructions and 1 μg of total RNA was used to prepare each RNA-seq library ...
-
bioRxiv - Microbiology 2021Quote: ... The qPCR reaction mixture (10 μL) comprised 1× Rotor-Gene SYBR green PCR mix (Qiagen), 500 nM of each primer ...
-
bioRxiv - Genomics 2020Quote: RNA was purified from approximately 1 × 107 CHM13 cells using an RNeasy kit (Qiagen; 74104) and prepared into Iso-Seq libraries following a standard protocol68 ...
-
bioRxiv - Genomics 2020Quote: ... S2 cells were transfected with 1 ug plasmid DNA using the Effectene reagent kit (Qiagen). The plasmid DNA which contains cDNA of FLAG-tagged ECDs are under the metallothionein promoter control ...
-
bioRxiv - Molecular Biology 2021Quote: ... Unbound Biotin-HPDP was removed by chloroform/isoamylalcohol (24:1) extraction in MaXtract tubes (Qiagen). RNA was precipitated with 10th volume of 5M NaCl and 1 volume of isopropanol ...
-
bioRxiv - Molecular Biology 2021Quote: ... The backbone was extracted from a 1% agarose gel using QIAquick Gel Extraction Kit (Qiagen) and the minigene insert was cleaned up using QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Biophysics 2019Quote: ... proteins were purified by batch Ni-NTA bead purification (1 mL slurry/1L culture; Qiagen) and further purified by a Superdex 200 16/60 column (GE Healthcare ...
-
bioRxiv - Cancer Biology 2019Quote: ... following the manufacturer’s instructions and treated twice with DNase I (1 unit/µg RNA, Qiagen). The RNA concentration was quantified using nanodrop2000 (Thermo Fisher ...
-
bioRxiv - Plant Biology 2019Quote: ... with 1 min shaking at 25 Hz in the Tissue Lyser II (Qiagen, Hilden, Germany). Ground tissue was stored at −80 °C ...
-
bioRxiv - Genetics 2019Quote: ... DNA from FFPE sample 6005-1 was extracted using QIAamp DNA FFPE Tissue Kit (Qiagen). Genomic DNA and RNA were extracted from peripheral blood leukocytes from patient 6003 and from a non-HHT control individual using the Gentra PureGene Blood Kit (Qiagen ...
-
bioRxiv - Genomics 2020Quote: ... The supernatant of cell lysate was incubated with 1 mL Ni-NTA agarose beads (QIAGEN) at 4 °C for 1 h ...
-
bioRxiv - Immunology 2019Quote: ... Purified RNA (1 μg) was reverse-transcribed to cDNA using RT2 First Strand Kit (Qiagen, Hilden ...
-
bioRxiv - Cell Biology 2019Quote: ... Co-NTA beads were obtained from stripping 1 mL of Ni-NTA resin from Qiagen in a Bio-rad gravity column with 50 mL of 0.5M EDTA (pH 8.0) ...
-
bioRxiv - Bioengineering 2020Quote: Genomic DNA was isolated from 1×106 tumor cells using DNeasy Blood & Tissue Kit (Qiagen). BCMA and CS1 loci amplicons ...
-
bioRxiv - Neuroscience 2020Quote: ... then converted to cDNA using 1 µg RNA and a QuantiTect Reverse Transcription kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... MCD360-1 and the F1 progenies using the DNeasy Plant Mini Kit (Qiagen, Valencia, CA). Equal amounts of DNA were pooled from 30 responsive as well as 30 non-responsive progenies for the INF1 recognition phenotype and 29 responsive and 30 non-responsive individuals for the SCR74 response phenotype ...
-
bioRxiv - Biochemistry 2021Quote: ... and the membrane suspension was mixed with 1 ml of Ni-NTA Superflow resin (Qiagen) per 1mg of GFP–His8 and incubated for 3 hours at 4 °C ...
-
bioRxiv - Bioengineering 2021Quote: RNA was extracted from ∼1 M cells using the QIAGEN RNeasy Mini Kit (QIAGEN 74104). A total of 36 samples were prepared ...
-
bioRxiv - Neuroscience 2020Quote: ... with all primers listed in Supplementary Table 1 and then purified (QIAGEN, PCR purification kit). Before nick translation ...
-
bioRxiv - Systems Biology 2021Quote: ... 1 μg total RNA was reverse transcribed using the miScript II Reverse Transcription kit (Qiagen) according to the manufacturer’s instructions (Jay and Ciaudo ...
-
bioRxiv - Microbiology 2020Quote: ... Cell debris were eliminated by centrifugation and 1 mL of Ni-NTA superflow beads (Qiagen) was added to bind his-tagged proteins ...
-
bioRxiv - Physiology 2021Quote: ... 20 μL reactions consisted of 1×QuantiFAST reaction mix containing ROX reference dye (Qiagen, Germany), 0.66 µM of forward and reverse primers ...
-
bioRxiv - Cancer Biology 2020Quote: ... Reverse cross-linking was performed by the addition of 0.2 mg ml-1 RNaseA (Qiagen) and 0.2 mg ml-1 Proteinase K (Promega) ...
-
bioRxiv - Cell Biology 2021Quote: ... we used the sample at a 1:1000 dilution in RNAse-free water (Qiagen, 129112) (2017) ...
-
bioRxiv - Molecular Biology 2022Quote: The supernatant was mixed with 1 ml resin volume of Ni-NTA beads (Qiagen, 30210) which was pre-equilibrated with Lysis buffer supplemented with 40 mM imidazole and 0.1 mM ATP ...
-
bioRxiv - Plant Biology 2022Quote: ... The lower part of the root (1 cm) was collected directly in RLT buffer (QIAGEN) and frozen in liquid nitrogen ...
-
bioRxiv - Biochemistry 2022Quote: ... a 1:2000 dilution of a mouse anti-Penta-His Alexa Fluor 647 conjugate (Qiagen) was used.
-
bioRxiv - Cancer Biology 2022Quote: ... cDNA was prepared from 0.5-1 μg RNA using a Quantitect Reverse Transcription Kit (Qiagen) and diluted to 2.5 ng/mL in DEPC-treated water ...
-
bioRxiv - Cancer Biology 2022Quote: Cells from knockdown control or shWDR5-1 group were harvested with QIAzol Lysis Reagent (Qiagen) and homogenized using QIAshredder tubes (Qiagen) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... the supernatant was purified by 1 mL Ni2+ IMAC with Ni-NTA Superflow resins (Qiagen). Resins with bound cell lysate were washed with 10 mL (bed volume 1 mL ...
-
bioRxiv - Genomics 2019Quote: ... Targeted PCR products were purified from 1% agarose gel using QIAquick Gel Extraction Kit (Qiagen) and Sanger sequenced (Eurofins Genomics ...
-
bioRxiv - Genomics 2019Quote: ... The solution was extracted with chloroform : isoamylalcohol (24:1) using MaXtractTM High Density Tubes (Qiagen) and precipitated with a 0.7 volume of isopropanol using a sterile glass rod to collect the DNA ...
-
bioRxiv - Molecular Biology 2019Quote: ... and DNA extracted using a Qiagen EZ-1 instrument using the DNA Investigator kit (Qiagen). Swab heads were processed according to Qiagen protocols ...
-
bioRxiv - Genomics 2020Quote: Total RNA was extracted from approximately 1 million cells using AllPrep DNA/RNA Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Genomic DNA (1 μg) was treated with bisulfite using an Epitect Bisulfite kit (Qiagen, Germany), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... homogenized in 1 ml of PBS with a steel ball by a Tissue Lyser (Qiagen) at 25 Hz for 1 min ...