Labshake search
Citations for Qiagen :
1251 - 1300 of 3116 citations for 1 2 Dihydro 1 2 tetrahydro 2H pyran 2 yl oxy ethyl 5H tetrazole 5 thione d4 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... or Junctional Adhesion Molecule 1 (JAM1) using Polyfect (Qiagen, CA, USA) and selected in 1000 µg/ml G418 for stable transfectants ...
-
bioRxiv - Microbiology 2020Quote: ... The supernatant was applied to 1 ml Ni-NTA Agarose (Qiagen) equilibrated with lysis buffer ...
-
bioRxiv - Microbiology 2020Quote: ... the supernatant was decanted and 1 mL QIAzol Lysis Reagent (QIAGEN) was added to resuspend the cell pellet and protect the RNA ...
-
bioRxiv - Microbiology 2020Quote: ... PCR#1 product was purified using Minielute PCR purification kit (Qiagen) and a second round of PCR amplification was performed with gene-specific primers R2 and forward F2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Proteinase digestion was performed with 1 mg/mL proteinase K (Qiagen) in the presence or absence of 1% Triton X-100 for 30 min at 37 °C as reported previously64 ...
-
bioRxiv - Cell Biology 2022Quote: ... added to 1 ml of washed Ni2+-NTA agarose (Qiagen, #1018244) and rotated on a low speed wheel for at least 1h at 4 °C ...
-
bioRxiv - Immunology 2022Quote: ... Homogenization was performed after adding 1 ml of inhibitex buffer (Qiagen) using the Bead Ruptor Elite bead mill homogenizer (Omni ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 ml binding buffer (provided in Qiagen PCR purification kit, #28106) and 20 µl of 3 M sodium acetate pH 5.5 (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... The supernatant was added to 1 mL Ni2+-NTA resin (Qiagen) and incubated for 1 hr at 4 °C ...
-
bioRxiv - Biophysics 2022Quote: ... Lysates were incubated with 1 ml of Ni-NTA resin (QIAGEN) in 4°C for 1 hr ...
-
bioRxiv - Genomics 2020Quote: ... Supernatant was loaded on two 1-ml Ni-NTA (Qiagen 30210) columns ...
-
bioRxiv - Physiology 2021Quote: ... and 1% β-mercaptoethanol with a TissueLyser II (Qiagen, Manchester, UK) at maximum speed for 2 minutes ...
-
bioRxiv - Cancer Biology 2021Quote: ... then diluted to 1 × 109 with 180 μL Buffer AE (Qiagen). Standard curves were prepared from 1 × 107 copies/rxn to 1 × 101 copies/rxn ...
-
bioRxiv - Plant Biology 2022Quote: ... the PCR products were ligated into expression vector pQE-1 (Qiagen) with T4 ligase (New England BioLabs) ...
-
bioRxiv - Plant Biology 2022Quote: ... samples were shaken for 1 min in a TissueLyser II (Qiagen) and then centrifuged at 4ºC for 5 min at maximum speed in a tabletop microfuge ...
-
bioRxiv - Neuroscience 2023Quote: ... 1% NP-40) and immediately placed in “RTL plus” buffer (Qiagen). The mRNA was purified using the RNase micro KIT (Qiagen) ...
-
bioRxiv - Neuroscience 2023Quote: ... 100 µl whole blood was homogenised in 1 ml QIAzol (Qiagen) using a TissueLyser II (Qiagen ...
-
bioRxiv - Molecular Biology 2024Quote: ... the remaining wash buffer was removed and 1 ml QIAzol (Qiagen) was added to the beads and incubated at RT for 10 min ...
-
bioRxiv - Bioengineering 2024Quote: ... 1 mL of 50% Ni-NTA agarose (Qiagen, Toronto, Ontario, Canada) was equilibrated using 10 bed volumes of wash buffer (same formulation as lysis buffer) ...
-
bioRxiv - Microbiology 2023Quote: ... then transferred to 1 ml RNAprotect Tissue Reagent (Qiagen, Hilden, Germany) for colonic transcript analyses ...
-
bioRxiv - Physiology 2023Quote: ... The tissue lysates were treated with 1% DNase (Qiagen, Hilden, Germany) and diluted to a protein concentration of 10μg/ml ...
-
bioRxiv - Microbiology 2023Quote: ... plus 1% ꞵ-mercaptoethanol and homogenized using a QIAshredder column (QIAGEN). RNA was extracted using the RNeasy Mini kit (QIAGEN) ...
-
bioRxiv - Microbiology 2023Quote: RNA was extracted from Caki-1 cells using the RNeasy (Qiagen) kit according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... at room temperature for 1 hour and Proteinase K (Qiagen 158918) at 55°C for 2 hours followed by a reverse cross-link at 65°C overnight ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 mL of washed Ni-NTA beads (Qiagen catalog no. 30210) were added for each 50 mg of total ubiquitin in the reaction ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 1 colonies using a DNeasy Plant Mini Kit (QIAGEN, Hilden, Germany). We used DNeasy Blood & Tissue Kits (QIAGEN ...
-
bioRxiv - Genomics 2023Quote: ... 1% SDS and 0.6 mg/mL Proteinase K (Qiagen, cat#19131) and 0.4 mg/mL RNaseA (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2023Quote: ... and the mixture was incubated with 1 mL Ni-NTA (Qiagen) beads at 4 ºC for 1 h to remove TEV protease ...
-
bioRxiv - Bioengineering 2024Quote: ... and 350 μL of lysis buffer (RLT + 1% β- mercaptoethanol, Qiagen) was perfused through each channel ...
-
bioRxiv - Molecular Biology 2024Quote: ... Reactions were then diluted 1:10 with nuclease-free water (Qiagen) and stored at −20°C until needed.
-
bioRxiv - Molecular Biology 2024Quote: ... The supernatant was mixed with 1 ml Ni-NTA beads (Qiagen), and washed with 10 ml PBS before use ...
-
bioRxiv - Microbiology 2024Quote: ... the supernatant was loaded onto a 1 ml StrepTactin column (Qiagen) at a flow rate of 0.7 ml/min in the ÄKTA prime-plus liquid chromatography system (GE Healthcare) ...
-
bioRxiv - Microbiology 2024Quote: ... containing 1% β-mercaptoethanol and 0.5% (v/v) Reagent DX (Qiagen). Tissues were then disrupted using the TissueRuptor (Qiagen ...
-
bioRxiv - Immunology 2024Quote: ... 1- 30k cells per population were lysed in RLT buffer (Qiagen) with 10 uL/mL 2-ME (Merck ...
-
bioRxiv - Bioengineering 2024Quote: ... supernatant was applied to 1 mL of Ni-NTA resin (Qiagen) for gravity chromatography ...
-
bioRxiv - Genomics 2022Quote: ... converted DNA was amplified using primers Fwd 5’ TTGATGGAGTAAAAGGAATTGTTTTAGG and Rev 5’ CCAATTCAAAAATTTAAAAAAAACAAAACC with HotStarTaq DNA Polymerase (QIAGEN). The PCR conditions were ...
-
bioRxiv - Molecular Biology 2023Quote: ... genomic DNA from 10 adult flies (5 males/5 females) was extracted using DNeasy Blood & Tissue Kit (Qiagen). DNA was resuspended and sheared in 1X TE (0.1 mM EDTA ...
-
bioRxiv - Synthetic Biology 2024Quote: ... an aliquot (5 µL) was treated with 0.5 µL of 5 mg/ml RNase A (QIAGEN, Hilden, Germany) at 37 °C for 30 min ...
-
bioRxiv - Genetics 2020Quote: ... 5 µl Multiplex PCR Master Mix (QIAGEN), 0.2 µM of M13-tailed forward primer ...
-
bioRxiv - Immunology 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Genomics 2020Quote: ... 5 μl of RLT plus buffer (QIAGEN) and 60 fg of λ-DNA were added into each isolated nucleus to lyse nucleus completely ...
-
bioRxiv - Immunology 2021Quote: ... 5 ml packed Ni-NTA resin (Qiagen) were equilibrated in lysis buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl RT primers ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 mm stainless steel beads (Qiagen). Phase separation was done by mixing 100 μl of Chloroform followed by centrifugation at 12000xg for 15 min in 4°C ...
-
bioRxiv - Immunology 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5 mm stainless steel beads (Qiagen). Sections were homogenized using a tissue lyser (Qiagen ...
-
bioRxiv - Neuroscience 2020Quote: ... Custom 5’ DIG labeled LNA probes (Qiagen) are as follows ...
-
bioRxiv - Immunology 2020Quote: ... or a 5 mm steel ball (Qiagen). For tissues ...
-
bioRxiv - Genetics 2020Quote: ... using 5 mm stainless steel bead (Qiagen) at 20 Hz for 4 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’; Qiagen), si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’ ...