Labshake search
Citations for Qiagen :
1201 - 1250 of 3581 citations for 6 Methyl 3 4 dihydro 2H pyrido 3 2 b 1 4 oxazine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Cells from the inserts were lysed and collected into RLT buffer containing B-mercaptoethnaol (QIAGEN) for downstream molecular analyses by RT-qPCR.
-
bioRxiv - Bioengineering 2021Quote: ... PCR 2 products were purified by 1% agarose gel using a QIAquick Gel Extraction Kit (Qiagen), eluting with 15 μL of Elution Buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Tissues were homogenized in a mixture of chloroform and methanol (2:1) using TissueLyser II (Qiagen) and dried in a Vacufuge (Eppendorf ...
-
bioRxiv - Immunology 2021Quote: DNA from 1-2 stool pellets was extracted using the QIAamp DNA Stool Mini Kit (Qiagen) as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Cultures samples were then mixed 1:2 with RNA Protect Bacteria Reagent (QIAGEN, Germantown, Maryland, USA), vortexed immediately for 5 seconds and incubated for 5 min at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... PCR products were then treated with DpnI for 1-2 hr and then purified (QiaQuick, Qiagen) before use in library construction.
-
bioRxiv - Microbiology 2023Quote: ... each spot was collected into a 1:2 mix of LBS and RNAprotect Bacteria reagent (Qiagen), incubated at RT for 5 minutes ...
-
bioRxiv - Systems Biology 2023Quote: ... About 1 OD/mL cells were mixed with 2 volumes of RNAprotect Bacteria Reagent (Qiagen, 76506), and the cell pellet was collected by centrifuging at 2500 g for 8 minutes at room temperature ...
-
bioRxiv - Genomics 2024Quote: ... DNA was extracted from 1 or 2 bumblebee legs using the DNeasy Blood & Tissue kit (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... For SAS-6 knock down experiments siNegative control (siNegative, Qiagen, 1027310) and siSAS-6 (siSAS6 on-TARGET smart pool ...
-
bioRxiv - Plant Biology 2022Quote: ... 6 or 24 h using an RNeasy Plant Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: RNA interference against MUS81 was performed using FlexiTube HsMUS81 6 (Qiagen) at final concentration of 10 nM using Lullaby 48 h before to perform experiments ...
-
bioRxiv - Developmental Biology 2024Quote: ... 6×105 cells were resuspended in 600 µl RLT buffer (Qiagen) and snap frozen on dry ice for later processing ...
-
bioRxiv - Immunology 2021Quote: Total RNA was extracted from fresh or cultured primary B cells using the RNeasy Minikit (Qiagen) or Trizol reagent (Ambion ...
-
bioRxiv - Immunology 2021Quote: ... RNA was isolated from the differentially stimulated B cells using the RNeasy Plus Micro Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: Genomic DNA was prepared from human or mouse B cells using QIAmp DNA Mini Kit (Qiagen), or from paraffin-embedded human IgD or IgA myeloma tissue sections (obtained from the University of Arkansas for Medical Science ...
-
bioRxiv - Immunology 2020Quote: Genomic DNA was extracted from B cell populations sorted in duplicates (Gentra Puregene Core Kit, Qiagen). Rearranged IGHV genes were sequenced by massive parallel sequencing ...
-
bioRxiv - Immunology 2021Quote: ... RNA was isolated from sorted B cells for each patient using the RNeasy Micro kit (Qiagen) with on-column DNase digestion ...
-
bioRxiv - Microbiology 2023Quote: ... gDNA was extracted using an isopropanol-ethanol purification kit (Puregene Yeast/Bact. Kit B from Qiagen) and following the manufacturer’s protocol including a 60-minute RNase A treatment ...
-
bioRxiv - Neuroscience 2020Quote: ... 2 μl diluted cDNA (1:20) were added to SYBR Green PCR Master Mix (Qiagen, Hilden, Germany) and 10 μM of both forward and reverse primer (Primer Sequences Table 1) ...
-
bioRxiv - Microbiology 2021Quote: ... The samples were homogenized for 2 × 1 min at 30 Hz using a TissueLyser (Qiagen, Hilden, Germany) and stored at -20 °C until further processing.
-
bioRxiv - Molecular Biology 2022Quote: ... and 1-2 µg of RNA was used for the cDNA synthesis (Omniscript RT Kit (Qiagen, 205111)) ...
-
bioRxiv - Immunology 2020Quote: ... in purity mode into 96-well microplates containing 10 μL of 1% 2-mercaptoethanol RLT buffer (Qiagen) and stored at −80°C ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA was isolated from 1-2 mm tail tissue using the DNeasy Blood and Tissue Kit (Qiagen) following the protocol for isolation of DNA from animal tissues and was eluted in 100 µl H2O ...
-
bioRxiv - Cell Biology 2020Quote: ... The siRNA oligonucleotides targeting Arf1 and IRSp53 were purchased from Qiagen (Flex-iTube GeneSolution GS375 for Arf1; siArf1#1 Cat. No. SI02654470; siArf1#2 Cat. No. SI00299250; Qiagen Flex-iTube IRSp53 siRNA#1 Cat ...
-
bioRxiv - Microbiology 2022Quote: ... The samples were homogenized (2 x 1 min at 30 Hz) by a TissueLyser (Qiagen, Hilden, Germany) and stored at -20 °C until next step ...
-
bioRxiv - Microbiology 2024Quote: ... 1 mL of culture (0′) was removed and mixed with 2 mL of RNAprotect Bacterial Reagent (QIAGEN), vortexed ...
-
bioRxiv - Neuroscience 2020Quote: ... and 6 h prior to RNA extraction with the RNeasy Minikit (Qiagen). Equal amounts were reverse transcribed via the QuantiTect Reverse Transcription kit (Qiagen) ...
-
bioRxiv - Neuroscience 2021Quote: ... 30s at 60°C on the Rotor-Gene Q 6-plex (QIAGEN). Mitochondrial copy number was calculated using the equation 2 × 2ΔCt ...
-
bioRxiv - Cell Biology 2022Quote: ... and 6×His-Flag-Ub was conducted using Ni-NTA agarose (Qiagen), following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 6 and 8 dpi using Qiazol and the RNeasy mini kit (Qiagen). Purified RNAs were processed using Turbo DNase (Ambion DNAfree kit) ...
-
bioRxiv - Genetics 2023Quote: ... for 6 hours before RNA extraction using the RNeasy Mini kit (Qiagen). Complementary DNA (cDNA ...
-
bioRxiv - Cancer Biology 2019Quote: RNA from CLL samples and B-cells was isolated by the RNAeasy® Mini kit by Qiagen. cDNA was synthesized using oligo-dT ...
-
bioRxiv - Immunology 2022Quote: Total mRNA was isolated from A20 cells and primary B lymphocytes using a RNeasy Mini Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: RNA was isolated from MACS-sorted splenic B cells with the RNA Mini Kit (Qiagen, Hilden, Germany). Quantification of RNA was performed with a NanoPhotometer (Implen ...
-
bioRxiv - Immunology 2021Quote: Total RNA was extracted from enriched B cells using the RNeasy Micro Kit (Qiagen, cat no. 74004) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: Splenic B cells were stimulated as indicated and RNA was isolated using RNeasy Plus Mini Kit (Qiagen). RT-PCR was carried out as described8 using the following primers ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was isolated from B-cells or mice tissue using RNA isolation kit (Qiagen, Valencia, CA) and then converted to complementary DNA using TaqMan Reverse Transcription kit (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2023Quote: ... total RNA was extracted from the B cells using the RNeasy Mini Kit (Cat. #74004, QIAGEN, Germany) as per the manufacturer’s instruction ...
-
SARS-CoV-2 comprehensive receptor profiling: mechanistic insight to drive new therapeutic strategiesbioRxiv - Cell Biology 2021Quote: ... each pre-incubated at a 2:1 molar ratio with Penta His Alexa Fluor 647 Conjugate (Qiagen, UK). Hits (duplicate AF647 positive spots ...
-
bioRxiv - Plant Biology 2020Quote: ... The clear supernatant was then gently mixed with 1 ml of Ni+2-NTA agarose beads (Qiagen, Germany) for 30 min and then added to the column with a flow rate of 0.5 ml/min ...
-
bioRxiv - Immunology 2022Quote: ... diluted in Milli-Q H2O 1:2 and the cells disrupted by mechanical lysis in the TissueLyser (Qiagen) for 2 minutes at 30 Hz and three freeze/thaw cycles (20° to -20°C).
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2019Quote: ... B cells from an individual experiment were pooled and used to isolate RNA with RNeasy Mini kit (QIAGEN). After treatment with Ambion Turbo DNase ...
-
bioRxiv - Immunology 2021Quote: Genomic DNA was isolated from B cells either using Blood and Tissue or Flexigene kits (Qiagen, Hilden, Germany). DNA was quantified with Qubit (ThermoFisher ...
-
bioRxiv - Cancer Biology 2020Quote: RNA was extracted from naïve and cultured B cells using Trizol and RNeasy kit and Dnase treatment (Qiagen) and retro-transcribed to cDNA using random hexamers (Roche ...
-
bioRxiv - Immunology 2020Quote: DAFhi and DAFlo GC B cells (CD19+ CD20+ CD38+ IgD−) were resuspended in RLT cell lysis buffer (Qiagen) after flow cytometric sorting ...
-
bioRxiv - Genetics 2019Quote: DNA was extracted from blood or cell lines using the Puregene Blood Core Kit B (Qiagen, Cat#158467). PCYT1A exons were PCR-amplified from SMD-CRD patient genomic DNA with Accuprime Taq polymerase (Invitrogen ...