Labshake search
Citations for Qiagen :
1151 - 1200 of 2514 citations for 7 Bromo 2 Methyl 1 Indanone since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... diluted 1:8 in PKD buffer (Qiagen) at 56°C for 1 hour with interval shaking ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1) DNeasy PowerLyzer PowerSoil Kit (QIAGEN®), 2 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Ni-NTA agarose beads (1 ml; Qiagen), washed and resuspended in loading buffer (50 mM Tris ...
-
bioRxiv - Immunology 2021Quote: ... 1-unit HotStarTaq Plus (QIAGEN, Cat#: 203607), 190 nM 3’ primer pool ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-1 (5’-UCGCUUUGGAUGGAAGUUCUA-3’, Qiagen), si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: Myosin-18A siRNA – #1 CACGAACTGGAGATGGATCTA (Qiagen SI04273668), #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
bioRxiv - Cell Biology 2021Quote: ... 25 nM of S1PR1 #1 (Qiagen, #SI00376201) 5’-ATGATCGATCATCTATAGCAA-3’ and 25nM S1PR1 #2 (Qiagen ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... stored in 1 ml RNAlater (Qiagen, Netherlands), and moved to a −20 °C freezer for up to a month until RNA was extracted ...
-
bioRxiv - Genetics 2019Quote: ... 1 μL of Q-Solution from Qiagen® and H2O ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 μM barcode LNA RT primer (Qiagen), 1U/μL RiboLock RNase inhibitor (Thermo Fisher Scientific) ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... containing 1 × Master Mix (Qiagen Multiplex Kit), 0.4 μg/μL of BSA ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 uL ∼1.07 AU/mL Protease (Qiagen) was added to each well and incubated at 37 °C for 40 min ...
-
bioRxiv - Microbiology 2023Quote: ... and 1 μL GlycoBlue coprecipitant (Qiagen; AM9515). RNA was precipitated after holding overnight at -80°C and centrifugation ...
-
bioRxiv - Biochemistry 2023Quote: ... anti-RGS-His (Qiagen, 1:2000, 34610), anti-Myc (ChromoTek ...
-
bioRxiv - Biochemistry 2022Quote: ... Mouse anti-His (Qiagen, 34670; 1:200) and goat anti-mouse IgG-AF488 (Invitrogen ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 1 μl Type-it Master Mix (Qiagen), 0.17 μM of either FAM or VIC ...
-
bioRxiv - Genetics 2023Quote: ... 1 ul of 25 mM MgCl2 (Qiagen) and 1 ul of the primer mix (40 uM of the Forward primer ...
-
bioRxiv - Microbiology 2023Quote: ... 1 mL RNAProtect Bacterial Reagent (Qiagen, #76506) was added to each sample and thawed on wet ice for 10 min ...
-
bioRxiv - Systems Biology 2024Quote: ... containing 1 mL of RNAProtect (Qiagen, 76506). The sorting rate was kept below 9000 events/s to minimize the false positive ratio and the flow rate was maintained at approximately 25-35 µL/min ...
-
bioRxiv - Genetics 2019Quote: ... cfDNA was extracted from 2 mL of plasma at baseline and from 3 mL of plasma post-treatment using QIAamp DNA purification kit (Qiagen, Venlo, the Netherlands) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... followed by lysis in a 2 mL sure-lock tube containing 5 mm stainless steel homogenization beads using the TissueLyser LT (Qiagen, Germantown, MD, USA) for 30 seconds at 30 hz followed by 1 min of 30 hz while keeping the sample cold ...
-
bioRxiv - Microbiology 2021Quote: ... transferred to the laboratory (within 2 hours) on ice and immediately processed for DNA extraction using the DNeasy PowerSoil kit (Qiagen, Valencia, CA, USA) according to manufacturer protocols ...
-
bioRxiv - Cancer Biology 2019Quote: ... First-strand cDNA was prepared from 2 µg of cellular RNA in a total reaction volume of 20 µL using the reverse transcriptase Omniscript (QIAGEN, Mississauga, ON, Canada). After reverse transcription ...
-
bioRxiv - Microbiology 2021Quote: Cellular total RNA was prepared from 2-4×106 cells for each sample using the RNeasy Plus Micro kit (Qiagen, Hilden Germany, #74034). For qRT-pCR ...
-
bioRxiv - Microbiology 2021Quote: ... were selected with a P<0.05 and 2-fold change in gene expression and used for network/pathway analysis using Ingenuity Pathway Analysis (IPA; Qiagen, Valencia, CA, USA) as described previously (5).
-
bioRxiv - Genetics 2020Quote: ... approximately 30 seeds per genotype were placed in a 2 mL Eppendorf Safe Lock tube along with one stainless steel bead (Qiagen Cat. No. 69989), frozen in liquid nitrogen ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Microsatellites were co-amplified in multiplex PCR (Table 2) with a Thermocycler T Gradient machine (Biometra, Goettingen, Germany) using the Qiagen® Multiplex PCR Kit (Qiagen, Hilden, Germany). Forward primers were 5’-labeled with fluorescent dyes HEX ...
-
bioRxiv - Genomics 2020Quote: ... DNA was extracted from peripheral blood leukocyte samples from visit 2 or 3 using the Gentra Puregene Blood Kit (Qiagen; Valencia, CA, USA) according to the manufacturer’s instructions (www.qiagen.com ...
-
bioRxiv - Genomics 2021Quote: ... Quantification of ACE2 transcript levels was performed by preparing total RNA from 2-4×106 cells for each sample using the RNeasy Plus Micro kit (Qiagen, Hilden Germany, #74034). For qRT-pCR ...
-
bioRxiv - Molecular Biology 2022Quote: Viral RNA was extracted from serially diluted and the 4 different media SARS-CoV-2 samples using the QIAamp Viral RNA Mini Kit (QIAGEN GmbH, Hilden, Germany). Briefly ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA extraction was performed from 25 mg (±2 mg) of arthropod powder with Qiagen Dneasy® Blood & Tissue extraction kit (Qiagen, Hilden – Germany) following the manufacturer’s protocol (see Sire et al ...
-
bioRxiv - Plant Biology 2024Quote: ... Tissue samples were ground by shaking with glass beads in a TissueLyser II (Qiagen, 2 pulses of 30 s each at 28Hz shaking). Leaf powder was suspended in 1.2 ml of cold nuclear isolation buffer (20 mM Tris-HCl ...
-
bioRxiv - Genetics 2024Quote: ... PCR products were run in a 2% agarose gel and the correct band (around 200 bp) was purified with QiaQuick gel extraction Kit (QIAGEN, catalog number 28706) (at least 2 columns ...
-
bioRxiv - Microbiology 2020Quote: ... and a plasmid expressing VSV-G or HIVKB9 envelope glycoproteins were cotransfected at the mass ratio of 9:1 (9 Hi.fate / 1 Env) using Effectene (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... or WT-Cav-1 (1 µg) plus EphB1-Y600F-YFP (2.5 µg using Superfect transfection reagent (cat #301305, Qiagen). Media was replaced 6 h after transfection with fresh DMEM media containing 10% FBS ...
-
bioRxiv - Physiology 2020Quote: ... insulin-like growth factor 1 receptor (Igf1r) and sirtuin 1 (Sirt1) gene promoters were designed using the Pyromark Assay Deisgn 2.0 software (Qiagen). PCR and sequencing primers are provided in Supplementary Table 1 ...
-
bioRxiv - Plant Biology 2022Quote: RNA was extracted from 10-day-old whole seedlings grown on 1/2X MS media containing 1% sucrose and 0.8% agar (Plant RNeasy kit (Qiagen)) ...
-
bioRxiv - Systems Biology 2023Quote: ... x mg solid matrix were mixed with five times the μl amount of ACN:water (1:1, v/v) and homogenised with a TissueLyser II (30 Hz, 10 min; Retsch Qiagen). After a short centrifugation (2 min ...
-
bioRxiv - Biochemistry 2023Quote: ... 10 µg⋅ml –1 Leupeptin and 3 mM Benzamidine) with steel beads at 28.5 Hz for 1 min (Qiagen TissueLyser II ...
-
bioRxiv - Molecular Biology 2021Quote: ... or 1 μl 1:10 diluted oligonucleotides (for RNA from immunopurified ribosomes) from the QIAseq FastSelect –rRNA Yeast Kit (Qiagen) in 10.5 μl total at 75°C ...
-
bioRxiv - Immunology 2021Quote: ... DNA was extracted from circulating PD-1+ and PD-1− CD8+ T cells using the All-Prep DNA/RNA Micro Kit from Qiagen and sent to Adaptive Biotechnologies for survey-level TCRβ sequencing.
-
bioRxiv - Microbiology 2019Quote: ... A second round of amplification was performed by transferring 5µl of 1:100 diluted Round 1 product into 15µl Fast Cycling PCR Mix (QIAGEN, Hilden, Germany) reactions ...
-
bioRxiv - Developmental Biology 2019Quote: Total RNA was extracted from FACS purified Zeb1+ (Lineage−Sca-1+CD49fhi tdTomato+) or Zeb1− basal cells (Lineage−Sca-1+CD49fhitdTomato−) using a RNeasy micro kit (Qiagen). cDNA was synthesized using the PrimeScript RT Reagent Kit (Takara) ...
-
bioRxiv - Cell Biology 2019Quote: ... Lentivirus carrying the response elements for type I (ISRE - #CLS-008L-1) or type II (GAS - #CLS-009L-1) upstream of firefly luciferase was purchased from Qiagen. Twenty-four hours post plating ...
-
bioRxiv - Neuroscience 2020Quote: ... at 60°C overnight and 1 μl of a 1:20 dilution of the lysate used in a PCR reaction (HotStarTaq, Qiagen). The sequence flanking the tmt-opsin1b TALEN binding sites was amplified using the forward 5’-GGGACTTTCTTTGCGCTTTA-3’ and the reverse 5’-CAGGTCAGAGCGGATCTCAT-3’ primers ...
-
bioRxiv - Cell Biology 2022Quote: ... The cleared lysate was then incubated with 3 mL of 1:1 Ni-NTA agarose slurry (Qiagen, product number 30210) for 1 hour ...
-
bioRxiv - Microbiology 2021Quote: ... qPCR reactions contained 4 μl of cDNA (1:50 dilution) and 200 nM of each primer (supplementary table 1) and QuantiTect SYBR Green PCR master mix (Qiagen) or SensiFAST SYBR Hi-ROX kit (Bioline) ...
-
bioRxiv - Bioengineering 2019Quote: ... the cells were washed once with 0.1% PBSA and incubated with 50 μL of a 1:100 dilution of anti-penta-His Alexa 647 antibody (Qiagen) for 10 minutes on ice ...
-
bioRxiv - Immunology 2019Quote: ... or M-MØ (1×106 cells/well) were transfected with 1 μg of the XRE reporter construct using either Superfect (Qiagen) or VIROMER RED (Lipocalix) ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were transfected with a 1:1 molar ratio of eGFP-P2A-Cas9 and single stranded oligonucleotide using Effectine (Qiagen) in a six-well dish ...