Labshake search
Citations for Qiagen :
1101 - 1150 of 2514 citations for 7 Bromo 2 Methyl 1 Indanone since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... DNA was extracted and purified from 20 mg (2 pellets) of stool from each mouse using the QIAamp Fast DNA Stool Mini Kit (Qiagen, Germantown, MD). The concentration of DNA in samples was determined by spectrophotometry ...
-
bioRxiv - Cell Biology 2022Quote: Genomic DNA was extracted from 2×105 primary human lung fibroblasts harvested in passage 3 using QIAamp Micro Kit (Qiagen, Hilden, Germany) following manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... 21 and 28 days post inoculation (dpi) and 2 μg was used to synthesize cDNA using the QuantiTect® Reverse Transcription Kit (Qiagen, CAD) following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2020Quote: ... bearing a C-terminal histidine tag (ACRO Biosystems, Newark, NJ) was coated at 2 μg/ml on a Ni-NTA plate (Qiagen, Valencia, CA). After washing and blocking ...
-
bioRxiv - Molecular Biology 2020Quote: Genomic DNA was extracted and purified from 2 g of samples with the cetyl trimethylammonium bromide (CTAB) method and Genomic-tip 100/G (Qiagen, Hilden, Germany) according to the standard DNA extraction method (EU-RL 2013) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Ligated DNA fragments ranging in size from 300 to 450 base pairs (bp) were extracted from 2% low-melt agarose gels and purified using a MinElute gel extraction kit (Qiagen, Valencia, CA). The recovered fragments were amplified using PCR ...
-
bioRxiv - Immunology 2020Quote: ... 1µg/ml Aprotinin, 1mM PMSF) using 5mm Stainless Beads and TissueLyser II (frequency: 30/sec, duration 2 × 30 sec) (Qiagen, Hilden, Germany). IL-23 was measured using either a mouse IL-23 ELISA (R&D ...
-
bioRxiv - Microbiology 2021Quote: ... Maize and soybean leaf and root tissue were pulverized for 2-min at a speed of 30 Hz with two 4-mm stainless balls in a TissueLyser II (Qiagen, Venlo, Netherlands). Total DNA was extracted from plant tissues with the OMEGA Mag-Bind Plant DNA Plus kit (Omega Bio-Tek ...
-
bioRxiv - Microbiology 2020Quote: Ticks were homogenised in a 2 ml reaction tube with two 5 mm steel beads and 500 μl PBS using a Tissue Lyser II (Qiagen, Hilden, Germany) for 3 min at 30 Hz ...
-
bioRxiv - Genetics 2021Quote: ... in length were extracted from a 2% agarose gel after electrophoresis and purified using a Qiagen Gel Extraction Kit (Qiagen, Hilden, Germany). The purified DNA was PCR amplified using GoTaq Colorless Master Mix (Promega ...
-
bioRxiv - Genomics 2020Quote: ... Realtime-qPCR was performed on 11 differentially expressed (DE) miRNAs based on miRNA-seq results (|FC| ≥ 2, P < 0.05) using miScript SYBR Green PCR Kit (Qiagen 218073, California, USA) according to the manufacturer’s instructions with StepOne Applied Biosystems real-time PCR machine (Applied Biosystems ...
-
bioRxiv - Neuroscience 2021Quote: ... 3-5 μg of DNA was isolated from frozen cortex of 2- and 12-month-old mice according to the manufacturer’s protocol (DNeasy Blood & Tissue Kit, Qiagen, Cat No. 69504) and diluted with 10 mM Tris ...
-
bioRxiv - Microbiology 2022Quote: SARS-CoV-2 RNA from the apical washes of the ALI HBE culture was isolated using QIAamp Viral RNA Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... HEK-293T cells were co-transfected with 0.15 µg of pCMV-Fusionred/SCN1B/SCN2B and 2 µg pcDNA3.1-SCN1A WT using 10 uL of PolyFect transfection reagent (QIAGEN; Germantown, MD, U.S.A.) in 35-mm culture dishes following the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2022Quote: ... The volume of mid-exponential phase culture to achieve 5 × 108 CFUs was calculated (assuming OD600 of 1.0 yields 109 CFUs/mL) and added to 2 volumes of RNAprotect Bacteria Reagent (QIAGEN, cat. no. 74124). The mixture was immediately vortexed for 5 sec ...
-
bioRxiv - Physiology 2022Quote: ... was broken up in 750 μl (TriFast USA) in a 2 ml Eppendorf (Hamburg, Germany) tube using the TissueLyzer (QIAGEN, Venlo, Netherlands) with stainless steel beads (5 mm) ...
-
bioRxiv - Physiology 2022Quote: ... Genomic DNAs of 61 weaned pups (2 pups died before weaning) were collected from their tails with a DNeasy Tissue kit (Qiagen, Valencia, CA). Six Ptger3-tTA BAC transgenic founder rats were identified by PCR for the presence of the tTAad-BGH insert ...
-
bioRxiv - Plant Biology 2022Quote: ... Tissue was ground to a fine powder at −80°C using 3-mm stainless steel beads at 50 Hz for 2*30 seconds in a TissueLyser LT (Qiagen, Germantown, USA). Ground samples were extracted with 1 mL of cold methanol containing [phenyl 13C6]-IAA (0.1 nmol/mL ...
-
bioRxiv - Microbiology 2024Quote: ... The pellets were resuspended with OMV buffer and re-pelleted again by centrifugation at 100,000 g (31,000 RPM) for 2 h at 4°C and lysed with Qiazol followed by RNA isolation with the miRNeasy kit (Qiagen, Germantown, MD) to obtain total RNA including the small RNA fraction ...
-
Epigenetic deregulation of IFN and WNT pathways in AT2 cells impairs alveolar regeneration (in COPD)bioRxiv - Cell Biology 2023Quote: Genomic DNA was extracted from 1-2×104 sorted alveolar epithelial cells isolated from cryopreserved lung parenchyma from 11 different donors using QIAamp Micro Kit (Qiagen, Hilden, Germany) following manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: Genomic DNA for the Pacific Bioscience Single Molecule Real-Time (SMRT) sequencing was prepared from 2 mL of fresh blood using the genomic-tip 100/G kit (Qiagen, Hilden, Germany). This was performed with additional RNase (Astral Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... 600 µl of lysis buffer (TES (0.1 M TRIS, 10 mM EDTA, 2% sodium dodecyl sulphate; pH 8) and Proteinase K (Qiagen, 20 mg/ml) in a 20:1 ratio ...
-
bioRxiv - Zoology 2023Quote: ... PCR products were amplified on a 2% agarose gel and amplicons were excised and cleaned using a gel purification kit (Qiagen, Hilden, Germany). Purified DNA was sequenced using both forward and reverse primers and Big Dye Terminator Cycling Sequencing at Azenta LLC (Plainfield ...
-
bioRxiv - Microbiology 2023Quote: RNA was extracted directly from the frozen samples with the addition of 2 ml of G2 DNA/RNA Enhancer (Ampliqon, Odense, Denmark) using the RNeasy PowerSoil Total RNA Kit (Qiagen, København, Denmark) with phenol:chloroform:isoamyl alcohol following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Aliquots of approximately 0.2 g of biomass pellets were further used for mDNA extraction also with the PowerLyzer® PowerSoil® DNA Isolation kit (QIAGEN).
-
bioRxiv - Plant Biology 2023Quote: ... QPCRs were run using the recommended protocol for 2× ProPlant SYBR Mix (Procomcure Biotech) on a Rotor-Gene Q (Qiagen, Hilden, Germany). Technical triplicates were performed for each sample ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA was treated with proteinase K at 42°C for 2 hrs and purified using MinElute PCR Purification Kit (Qiagen, Cat# 28004).
-
bioRxiv - Biochemistry 2023Quote: Mouse liver RNA was extracted from 10 mg (± 2 mg) of preserved tissue using RNEasy kits and QIAshredders (QIAGEN; Germantown, MD, USA). Aliquots of RNA from each sample were assessed on an Agilent 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Plant Biology 2023Quote: ... Collected tissue was ground to a fine powder at -80°C using 3 mm stainless steel beads at 50 Hz for 2*30 seconds in a TissueLyser LT (Qiagen, Germantown, USA), and between 10-15 mg of ground tissue per sample was used for auxin extraction ...
-
bioRxiv - Developmental Biology 2024Quote: ... Final PCR products of 250–500 bp were excised from a 2% agarose gel and purified using a gel purification kit (Qiagen, Catalog # 28604) according to the manufacturer’s instructions.
-
bioRxiv - Genetics 2024Quote: DNA was prepared from tail biopsies obtained at approximately 2-weeks of age (Gentra Puregene Mouse Tail Kit, Qiagen, Valencia, CA, USA). Scn1a genotype was determined as previously described (Kearney et al ...
-
bioRxiv - Microbiology 2024Quote: ... Bacteria were then mechanically disrupted using a bead beater homogenizer (PowerLyzer 24, Qiagen; 2 cycles of 45s 5000 rpm / 5 min ice). After an additional 5 min on ice ...
-
bioRxiv - Genomics 2020Quote: ... PCR products were cleaned-up using 1:1 of SPRI beads and eluted in 30µl elution buffer (Qiagen). The resulting amplicons were assayed on the Fragment Analyzer System (Agilent) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 ml of the non-stressed culture was added to 1 ml of the RNAprotect Bacteria Reagent (Qiagen), vortexed and incubated for 5 min at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... Flow-through was mixed 1:1 with 70% ethanol and passed through a RNeasy Mini column (Qiagen, #74104). After centrifugation ...
-
bioRxiv - Biochemistry 2024Quote: ... ∼8 ml PCR product (azide-DNA:2xbiotin-DNA = 1:1) was purified using HiSpeed Plasmid Maxi kit (Qiagen) in 1 ml NaHCO3 (pH 8.3) ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-His tag (1:2000; QIAGEN) and rabbit anti-GST (1:2000 ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA) (Qiagen, Hs_PLCE1_1, SI00115521); negative control siRNA (UUCUCCGAACGUGUCACGUdTdT ...
-
bioRxiv - Microbiology 2020Quote: ... 1× Qiagen Multiplex Master Mix (QIAGEN, Germany) and 5 μL of template DNA in a 15 μL reaction ...
-
bioRxiv - Developmental Biology 2022Quote: ... containing DNase I (1 mg/ml, Qiagen) at 37 °C for 5 min with gentle shaking ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 1 ml of Proteinase K (Qiagen, 19131) was added to the tube and vortexed for 5 seconds ...
-
bioRxiv - Systems Biology 2022Quote: ... resuspended in 1 mL QIAzol reagent (Qiagen) and stored at -80 °C.
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-His from Qiagen (1:10,000), home-made rabbit anti-VASH1 ...
-
bioRxiv - Cancer Biology 2019Quote: ... diluted 1:8 in PKD buffer (Qiagen) at 56°C for 1 hour with interval shaking ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 1 mL of Ni-NTA Agarose (Qiagen) was added to a 15 mL polypropylene gravity flow column (Qiagen) ...
-
bioRxiv - Genomics 2019Quote: ... and 1 U Taq DNA polymerase (Qiagen). A positive control of DNA extracted from commercially available Agaricus bisporus provided by Dr ...
-
bioRxiv - Genomics 2019Quote: ... and 1 U Taq DNA polymerase (Qiagen). The fungal-specific ITS1F/ITS4 and bacteria-specific 341F/805R primer pairs were used for each sample in two independent PCR reactions ...
-
bioRxiv - Genetics 2019Quote: ... 1×106 cells using RNeasy Kit (Qiagen), followed by DNase digestion using TURBO DNase (Thermo Fisher) ...
-
BCR analysis of single-sorted, putative IgE+ memory B cells in food allergy: an ephemeral existence?bioRxiv - Immunology 2019Quote: ... 1 unit of HotStar Plus Taq (Qiagen), 200 nM of each primer ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 mM DTT using a TissueRuptor (Qiagen). The homogenate was then centrifuged 5 min at 2,500 x g at 4°C and the supernatant transferred to a new tube on ice followed by further homogenisation using a 27G needle and syringe ...