Labshake search
Citations for Qiagen :
1051 - 1100 of 10000+ citations for DNA Mismatch Repair Protein Msh3 MSH3 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: Microbial metagenomic DNA was extracted with a QIAamp PowerFecal Pro DNA Kit (QIAGEN, Hilden, Germany). Snap-frozen rodent colon contents stored at -80°C were scraped and used for DNA extraction ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA was extracted using the QIAamp® DNA Blood Mini Kit (Qiagen, Hilden, Germany), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... Sample genomic DNA extraction was performed using the Qiagen QIAamp DNA Micro Kit (Qiagen, 56304). Extracted genomic DNA was digested overnight at 37°C with DpnI (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: DNA from PDO cells was extracted using the AllPrep DNA/RNA Mini Kit (Qiagen, Germany). Library preparation was performed using a QIASeq™ custom targeted 30 gene DNA panel (Qiagen ...
-
bioRxiv - Molecular Biology 2022Quote: DNA and RNA were extracted from mucosoid cultures using the QIAamp DNA Mini Kit (Qiagen) and Trizol (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: Genomic DNA was extracted from sorted cell suspensions using the QIAAmp DNA Micro Kit (Qiagen), and DNA concentration was measured using a NanoDrop (ThermoFisher) ...
-
bioRxiv - Microbiology 2022Quote: ... then DNA from cultures was extracted using the QiAamp DNA Mini Kit (Qiagen, Germantown, MD) following manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: Mitochondrial DNA was amplified using the REPLI-g Mitochondrial DNA kit (Qiagen, cat no 151023) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: Genomic DNA of host isolates were extracted with QIAamp DNA mini kit (Qiagen, Hilden, Germany). Host isolates were subjected to sequencing to analyse the prophage regions and genetic factors responsible for antimicrobial resistance and virulence/toxins.
-
bioRxiv - Cancer Biology 2022Quote: ... Genomic DNA from all samples was extracted using a QIAamp DNA tissue mini kit (Qiagen). Barcode preamplification ...
-
bioRxiv - Microbiology 2022Quote: ... Homogenate was used for DNA extraction by QIAamp Pro DNA Kit (51804, Qiagen, Duesseldorf, Germany). Sterile DNA-free water was used as negative controls.
-
bioRxiv - Genetics 2022Quote: ... Genomic DNA extraction was performed with Qiagen genomic DNA extraction kit (Qiagen, Germantown, MD, USA). DNA concentrations were determined by Nanodrop (ThermoFischer Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... Genomic DNA was obtained from fecal samples using the QIAamp power fecal DNA kit (Qiagen), and DNA concentration was determined using a TECAN Fluorometer (Qubit® dsDNA HS Assay Kit ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was extracted by using the QIAamp® DNA Stool kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s protocol (Claassen et al. ...
-
bioRxiv - Microbiology 2020Quote: ... the genomic DNA were extracted from the cells using Qiagen DNA mini kit (Qiagen, USA) according to manufacturer’s manual and quantified using Nanodrop2000 spectrophotometer (ThermoFisher).
-
bioRxiv - Microbiology 2020Quote: ... Total DNA was extracted from the biofilm samples using the PowerSoil DNA Isolation kit (QIAGEN) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: DNA was extracted from muscle tissues using QIAamp DNA Tissue Kit (QIAGEN Inc., Hilden, Germany) following the standard protocols ...
-
bioRxiv - Microbiology 2020Quote: DNA was extracted from sediment samples using the PowerSoil DNA Isolation Kit (12888-50, QIAGEN). Amplification of the v3-4 region of the bacterial 16S rRNA genes and the v4-5 region of the archaeal 16S rRNA genes ...
-
bioRxiv - Microbiology 2020Quote: ... The DNA was extracted from the frozen skin using the QIAamp DNA Micro Kit (Qiagen) following the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was extracted by using the QIAamp® DNA Stool kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s protocol (Claassen et al. ...
-
bioRxiv - Microbiology 2021Quote: ... and DNA isolation using the QIAamp Blood DNA Mini Kit according to manufacturer instructions (Qiagen). Real Time-quantitative PCR (RT-qPCR ...
-
bioRxiv - Microbiology 2021Quote: Total genomic DNA was isolated using the MagAttract® HMW DNA kit (Qiagen, Hilden, Germany). To prepare 500 bp paired-end libraries of all isolates we used the Nextera XT DNA Library Preparation kit (Illumina ...
-
bioRxiv - Bioengineering 2021Quote: ... DNA was extracted by using the QIAamp® DNA Stool kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s protocol (Claassen et al. ...
-
bioRxiv - Microbiology 2021Quote: ... fecal or cultured bacterial DNA was isolated using QIAamp Fast DNA Stool Mini Kit (Qiagen) following the kit protocol ...
-
bioRxiv - Microbiology 2021Quote: Genomic DNA was isolated using the MagAttract PowerMicrobiome DNA/RNA kit (Qiagen, Germantown, MD, USA) on the epMotion ® 5075 liquid handler (Eppendorf ...
-
bioRxiv - Molecular Biology 2022Quote: DNA was extracted from buffy coat and BAL using the QIAamp DNA Mini Kit (Qiagen). Single-genome amplification of a subgenomic HIV region (nef ...
-
bioRxiv - Immunology 2022Quote: DNA was extracted from KO cells using the QIAamp® DNA Mini Kit (#51304, Qiagen), followed by a genomic PCR with Q5® High-Fidelity DNA Polymerase (#M0491S ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... DNA for anemones from each location was isolated with the AllPrep DNA/RNA kit (Qiagen) using the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: Genomic DNA of mESCs was extracted by using a QIAamp DNA mini kit (QIAGEN, 51306). For hACE2 mESCs ...
-
bioRxiv - Cancer Biology 2020Quote: ... The genomic DNA was isolated using the QIAamp DNA Mini Kit (Qiagen, Cat. No. 51306) and DNA concentrations were measured on the Epoch microplate spectrophotometer (BioTek) ...
-
bioRxiv - Cancer Biology 2020Quote: Lung genomic DNA was extracted from frozen lungs using the QIAmp DNA mini kit (Qiagen) for qPCR analysis ...
-
bioRxiv - Molecular Biology 2021Quote: ... genomic DNA was extracted alongside the RNA with the AllPrep DNA/RNA mini kit (Qiagen). Genomic DNA samples were processed further at the Barts and the London Genome Centre and run on Infinium MethylationEPIC arrays (Illumina).
-
bioRxiv - Molecular Biology 2021Quote: ... Genomic DNA was extracted 72 hours post-transfection with the QIAamp DNA Mini Kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... Genomic DNA was extracted 72 hours post-transfection with the QIAamp DNA Mini Kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... Genomic DNA was extracted 72 hours post-transfection with the QIAamp DNA Mini Kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: DNA isolation was performed according to a modified QIAamp Fast DNA Stool Mini Kit (Qiagen) protocol that included a bead beating step with MoBio garnet beads ...
-
bioRxiv - Genomics 2020Quote: ... DNA was isolated from flash frozen cell pellets using the QIAamp DNA Micro kit (Qiagen) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2020Quote: ... and DNA was extracted from each sample using QIAamp DNA Blood Mini Kits (Qiagen 51104).
-
bioRxiv - Genomics 2021Quote: DNA was extracted using the Qiagen AllPrep DNA/RNA Mini Kit (Qiagen Ltd, Manchester, UK) and genotyped for rs6600247 using TaqMan SNP assay (custom order by Life Technologies ...
-
bioRxiv - Genomics 2021Quote: ... Genomic DNA was prepared from PBMCs or whole blood using QiaAmp DNA Blood kit (Qiagen), or phenol/chloroform extraction.
-
bioRxiv - Genomics 2021Quote: Genomic DNA was extracted from the samples using the AllPrep DNA/RNA MiniKit (Qiagen, 80204) following the user manual guidelines ...
-
bioRxiv - Genomics 2021Quote: ... DNA samples were extracted from blood specimens by the QIAamp DNA Blood Mini Kit (QIAGEN). Concentration and purity were checked through the Qubit fluorometer and the Nanodrop spectrophotometer (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was extracted from treated sediments by using the PowerSoil DNA isolation kit (Qiagen, Germany). The 16S amplicon libraries targeting the V3-V4 regions of 16S rRNA genes [48] were prepared according to the Illumina 16S metagenomic sequencing library preparation guide by using a gel purification approach as described previously [23] ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Genomic DNA in FFPE sections was extracted using the AllPrep DNA/RNA FFPE Kit (Qiagen). Genomic DNA in frozen lung tissues from two P ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA was extracted alongside the genomic DNA with the AllPrep DNA/RNA mini kit (Qiagen). RNA samples were DNase treated (Thermo Scientific ...
-
bioRxiv - Genomics 2021Quote: Genomic DNA of homogenised soil was extracted using PowerSoil DNA extraction kits (Qiagen, Hilden, Germany). Approximately 0.25 g of soil was extracted from each sample with minor modifications to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were harvested and DNA purified using the Blood and Tissue DNA kit (Qiagen, MD). A 241 base pair amplicon spanning the AAVS1 target site was amplified in 25 cycles using NEB One Taq (AAVS1 −80bp Forward 5’ GACCACCTTATATTCCCAGG ...
-
bioRxiv - Evolutionary Biology 2021Quote: Enrichments were concentrated and genomic DNA was extracted using a QIAamp DNA Mini Kit (Qiagen). qPCR analysis was performed according to temperature conditions as previously described (Grant et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... Genomic DNA was isolated from cultured fibroblast or blood with QIAmp DNA Mini kit (QIAGEN). The mutations in the two Coriell fibroblast lines — BBS10A ...
-
bioRxiv - Genomics 2020Quote: Genomic DNA was extracted from whole blood using either MagAttract HMW DNA Kit (QIAGEN, Germany) or NucleoSpin Blood Kit (Macherey-Nagel ...