Labshake search
Citations for Qiagen :
901 - 950 of 10000+ citations for DNA Mismatch Repair Protein Msh3 MSH3 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2023Quote: ... Genomic DNA was amplified with the REPLI-g Advanced DNA Single Cell Kit (Qiagen), and successful amplification of chytrid DNA was verified by PCR with the primers ITS4ngsF (5’-GCATATCAATAAGCGSAGGA-3’ ...
-
bioRxiv - Microbiology 2023Quote: Fecal and cecal DNA were extracted using the QIAamp DNA Stool Mini Kit (Qiagen) according to the manufacturer’s protocol with modifications ...
-
bioRxiv - Immunology 2023Quote: ... DNA was extracted using QIamp Fast DNA Stool Mini Kit following manufacturer’s instructions (Qiagen). RNA was extracted and purified using a RNeasy mini kit (Qiagen) ...
-
bioRxiv - Cell Biology 2023Quote: ... DNA was isolated using the QIAamp DNA blood mini kit (51106, Qiagen, Hilden, Germany) according to manufacturer’s protocol after a couple of days and CRISPR/Cas9 induced editing efficiency was analyzed by PCR and separation of amplicon on 2% agarose gel containing 1:10.000 GelRed nucleic acid gel stain (41003 ...
-
bioRxiv - Cancer Biology 2022Quote: DNA was isolated from the frozen samples using a QIAamp DNA Mini kit (QIAGEN) with RNAse treatment and from the FFPE sample with a turXTRAC FFPE DNA kit (Covaris) ...
-
bioRxiv - Immunology 2022Quote: DNA was extracted from stool samples using QIAmp Fast DNA Stool Mini Kit (Qiagen). 16S rRNA V3 and V4 regions were amplified by PCR using Kapa Hifi Hotstart Ready Mix (KAPA Biosystems ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA and DNA were extracted using the AllPrep DNA/RNA/miRNA Universal Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Mitochondrial DNA was extracted using QiAamp DNA mini kit following the manufacturer instructions’ (Qiagen). DNA was quantified using Sybr Select Master Mix (Applied Biosystems) ...
-
bioRxiv - Systems Biology 2022Quote: DNA was extracted using a blood and cell culture DNA mini kit (13323, Qiagen) from low passage cell lines ...
-
bioRxiv - Microbiology 2022Quote: ... and genomic DNA (gDNA) was extracted using the QIAamp DNA Blood Midi Kit (Qiagen). The concentration of gDNA was quantified using the Qubit dsDNA BR assay kit and measured with a Qubit 2.0 fluorometer (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... DNA was extracted from the dissected M4 by the QIAamp DNA Mini Kit (Qiagen), and real-time qPCR was performed using primers opcP-F and opcP-R (SI Appendix ...
-
bioRxiv - Cell Biology 2024Quote: DNA was isolated from ShCtrl and ShOpa1 cells using DNA extraction lysis buffer (Qiagen). The mitochondrial DNA (mtDNA ...
-
bioRxiv - Microbiology 2024Quote: ... DNA was extracted from pellets using the DNeasy PowerFood Microbial DNA Isolation Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... we extracted DNA from untouched and nucleofected cells using QIAamp DNA Mini Kit (Qiagen). Next ...
-
bioRxiv - Physiology 2023Quote: DNA was extracted from single fecal pellets using the PowerSoil DNA isolation kit (QIAGEN) on the automated QIAcube platform using the inhibitory removal technology (IRT ...
-
bioRxiv - Cancer Biology 2024Quote: DNA isolation was performed using the Blood and Cell Culture DNA Mini Kit (QIAGEN). The isolated DNA samples were sent to the Center for Applied Genomics at the Children’s Hospital of Philadelphia for the SNP array analysis using the Infinium Global Screening Array-24 v3.0 Kit (Illumina) ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were harvested and genomic DNA extracted using QIAmp UCP DNA Micro kit (QIAGEN). The targeted loci were PCR amplified with NGS adaptors and sent for amplicon sequencing (Primers Table 1 “Panc480 mutation validation” & 3 ...
-
bioRxiv - Genomics 2023Quote: ... pulcherrimus genomic DNA was extracted by using Blood & Cell Culture DNA Midi Kit (QIAGEN), and short genomic DNA segments were removed by Short Read Elimination XL Kit (Circulomics Inc.) ...
-
bioRxiv - Genomics 2023Quote: Bacterial genomic DNA was isolated using the UltraClean microbial DNA extraction kit (Qiagen, Germany) and sequenced with a PacBio RS II sequencer (Pacific Biosciences ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... The DNA of 307 samples was extracted with QIAamp DNA Stool Mini Kit (Qiagen) using TE (1 M Tris-Cl ...
-
Epigenetic deregulation of IFN and WNT pathways in AT2 cells impairs alveolar regeneration (in COPD)bioRxiv - Cell Biology 2023Quote: ... Total RNA and DNA was isolated using AllPrep DNA/RNA Micro Kit (QIAGEN, 80284).
-
Epigenetic deregulation of IFN and WNT pathways in AT2 cells impairs alveolar regeneration (in COPD)bioRxiv - Cell Biology 2023Quote: ... and RNA and DNA were isolated using the AllPrep DNA/RNA micro kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... DNA extraction was performed using Qiamp DNA Blood Mini Kit (Qiagen® Inc., USA), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: Prior to DNA extraction from ulcerative lesion samples using the QIAamp DNA kit (Qiagen), sonication and DNAse/RNAse treatment was performed [8] ...
-
bioRxiv - Biochemistry 2023Quote: Genomic DNA was extracted from screen pellets using QIAamp DNA Blood Maxi Kit (QIAGEN) and gRNAs were isolated using PCR ...
-
bioRxiv - Bioengineering 2023Quote: ... the DNA of the cells was collected using QIAamp DNA Mini Kit (QIAGEN, #51304). The Q5 DNA polymerase (New England Biolabs ...
-
bioRxiv - Genomics 2023Quote: ... the DNA was obtained using a Plant Pro DNA extraction kit (Qiagen, Germantown, MD) with no additions to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2024Quote: Genomic DNA was extracted from each individual using the Biosprint DNA Blood Kit (Qiagen) on a Thermo KingFisher Flex automated extraction instrument ...
-
bioRxiv - Microbiology 2024Quote: ... and DNA from cultures was extracted using the QiAmp DNA minikit (Qiagen, Germantown, MD) according to manufacturer instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... DNA from blood samples was isolated using the QIAsymphony DSP DNA Mini Kit (Qiagen) or the QIAamp DNA Blood Mini Kit (Qiagen) ...
-
bioRxiv - Microbiology 2022Quote: ... was performed by DNA extraction according to manufacturer’s specifications (QiaAmp DNA minikit, QIAGEN, Courtaboeuf) on 1/10 of the harvested volume ...
-
bioRxiv - Cancer Biology 2022Quote: Genomic DNA was purified from cell pellets using the QIAamp DNA Mini Kit (Qiagen). A 200-275 base pair region containing the relevant sgRNA target sequence was PCR-amplified from genomic DNA using the NEBNext High-Fidelity 2X PCR Master Mix (New England BioLabs ...
-
bioRxiv - Genomics 2022Quote: ... DNA sequencing libraries were produced using the GeneRead DNA Library I Core Kit (Qiagen) and Netflex Dual-index DNA Barcodes (Perkin Elmer ...
-
bioRxiv - Genomics 2022Quote: Long DNA was extracted from BmN4 cells using Blood & Cell Culture DNA Kit (QIAGEN), sequencing libraries were prepared using Rapid Sequencing Kit (Oxford Nanopore) ...
-
bioRxiv - Genomics 2022Quote: DNA and RNA were extracted from samples using AllPrep DNA/RNA Mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: Total DNA was extracted from the cells with FlexiGene DNA Kit (51206, Qiagen, Germany) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... Total DNA was isolated using the QIAGEN QIAamp DNA Mini Kit (Qiagen, Hilden, Germany), following the manufacturer’s protocol “DNA Purification from Tissues” ...
-
bioRxiv - Microbiology 2022Quote: ... knowlesi genomic DNA obtained from Pk infected erythrocytes using a DNA blood kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... DNA extraction was performed using the Blood & Cell Culture DNA Maxi Kit (Qiagen Inc.) and RNA extraction was performed using the RNeasy Midi Kit (Qiagen Inc. ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from biomass on filters using the PowerSoil DNA Isolation Kit (Qiagen) using the manufacturer’s protocol with the exception that diced filters were added to the bead tube in place of soil ...
-
bioRxiv - Biochemistry 2023Quote: Genomic DNA was extracted from cell pellets using QiaAMP DNA Mini Kit (Qiagen, 51306). Barcodes were PCR amplified using 5’- GATATTGCTGAAGAGCTTG and 5’- CCAGAGGTTGATTGTTCCAGA ...
-
bioRxiv - Cancer Biology 2023Quote: Genomic DNA of mutant cells was isolated using DNA Blood Mini Kit (QIAGEN, 51106) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA from each clone was extracted using the QIAamp® DNA Mini Kit (Qiagen).
-
bioRxiv - Genomics 2023Quote: ... The eluted DNA was then further purified with the MagAttract HMW DNA kit (Qiagen) per the manufacturer’s whole blood purification protocol ...
-
bioRxiv - Genomics 2023Quote: ... DNA was then extracted from the lysate using the QIAamp DNA Mini Kit (Qiagen) with a modified protocol as follows ...
-
bioRxiv - Genomics 2023Quote: ... The eluted DNA was then further purified using the QIAamp DNA mini kit (Qiagen) by diluting the DNA to a final volume of 200 μL and final 1x PBS concentration ...
-
bioRxiv - Genetics 2023Quote: We extracted genomic DNA from scats using QIAamp DNA Mini Stool Kit (Qiagen, Germany) following manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2023Quote: ... followed by proteinase K digestion and DNA isolation with QIAmp DNA Mini Kit (Qiagen), following the manufacturer instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... DNA was extracted from the sampled specimens using the QIAamp DNA Micro kit (Qiagen). Given the fragility of these old samples ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... DNA was extracted from a single female using the QIAamp DNA Micro Kit (Qiagen) according to the manufacturer’s instructions.