Labshake search
Citations for Qiagen :
1001 - 1050 of 10000+ citations for C Reactive Protein CRP ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2020Quote: ... or DNAse (200 Units well−1, 1 hr, 37°C, Qiagen). DAPI was stained at 0.5 μM (5 mins ...
-
bioRxiv - Plant Biology 2024Quote: ... or Ni-NTA agarose column (Qiagen, for 6XHis-EIN2-C purification) according to manufacturer’s menu followed by sonication ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eIF3B – C 2: GACCGACTTGAGAAACTCAAA) were synthesized by QIAGEN (Hilden, Germany). For transfection ...
-
bioRxiv - Biochemistry 2023Quote: ... Plant samples were homogenized at -80 °C in a TissueLyser (Qiagen) and resupendend in a 10-fold excess of 80% (w/v ...
-
bioRxiv - Molecular Biology 2021Quote: ... Proteins were purified using Ni-NTA agarose (Qiagen) and eluted using 300 mM imidazole in purification buffer ...
-
bioRxiv - Genetics 2020Quote: ... Proteins were purified with Ni-NTA beads (Qiagen). Proteins and beads were washed 3 times with protein purification lysis buffer before incubating the beads with elution buffer (400 mM imidazole in protein purification lysis buffer ...
-
bioRxiv - Biochemistry 2020Quote: ... Protein was purified using Ni-NTA agarose (Qiagen) eluting with 300 mM imidazole ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Proteins were purified with Ni-NTA Resin (Qiagen) using standard protocols ...
-
bioRxiv - Neuroscience 2021Quote: ... Proteins were purified using Ni-NTA agarose (Qiagen) resin first ...
-
bioRxiv - Biochemistry 2022Quote: ... Protein Center (Thermo) and Ingenuity Pathways Analysis (Qiagen). For protein center analysis ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Proteins were purified on Ni-NTA resin (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... Proteins were purified using Ni-NTA agarose (QIAGEN), followed by size-exclusion chromatography using HiLoad 16/600 Superdex200 columns (GE Healthcare Life Sciences) ...
-
bioRxiv - Plant Biology 2023Quote: ... The proteins were purified using Ni-NTA (Qiagen), and the His tag was cleaved by the Tev protease ...
-
bioRxiv - Microbiology 2023Quote: ... SrtC2 protein was purified using Ni-NTA (Qiagen) affinity chromatography with the addition of 5 mM β-mercaptoethanol in all buffers ...
-
bioRxiv - Biochemistry 2024Quote: ... Proteins were affinity-purified with NiNTA agarose (Qiagen). The eluate was further purified over a Source 15 Q column (Cytiva) ...
-
bioRxiv - Immunology 2021Quote: ... washed with PBS using a 96-well plate manifold base (Qiagen) connected to the vacuum and eluted into 96-well PCR plates using 86 μL of 0.1 M glycine-HCL buffer pH 2.7 ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCR amplification was performed in 384-well pick&mix plates (Qiagen) with customized selection of 192 LNA-enhance primers to detect 187 endogenous microRNAs and 5 spike-in controls per sample ...
-
bioRxiv - Immunology 2021Quote: ... washed with PBS using a 96-well plate manifold base (Qiagen) connected to the vacuum and eluted into 96-well PCR plates using 86 μl of 0.1 M glycine-HCL buffer pH 2.7 ...
-
bioRxiv - Immunology 2020Quote: ... washed with PBS using a 96-well plate manifold base (Qiagen) connected to the vacuum ...
-
bioRxiv - Immunology 2020Quote: ... washed with PBS using a 96-well plate manifold base (Qiagen) connected to the vacuum and eluted into 96-well PCR plates using 86 μl of 0.1 M glycine-HCL buffer pH 2.7 ...
-
bioRxiv - Physiology 2022Quote: Cells were lysed directly in the plate using Buffer RLT (Qiagen) with 10uL/mL 2-mercaptoethanol following a quick PBS rinse ...
-
bioRxiv - Molecular Biology 2023Quote: ... The plate was then processed in the PyroMark Q24 pyrosequencer (Qiagen). Results were analyzed with PyroMark Q24 Advanced 3.0.1 software ...
-
bioRxiv - Immunology 2023Quote: ... RT qPCR was conducted with custom array plates (330171, Qiagen, Canada) using the LightCycler 480 Real-Time PCR system (Roche Molecular Systems Inc. ...
-
bioRxiv - Microbiology 2023Quote: ... and a 96-well PowerMag Glass Bead plate (Qiagen, Hilden, Germany). The Glass Bead Sterilizer was turned on ...
-
bioRxiv - Molecular Biology 2024Quote: ... washed with PBS using a 96-well plate manifold base (Qiagen) connected to the vacuum and eluted into 96-well PCR plates using 86 μl of 0.1 M glycine-HCl buffer ...
-
bioRxiv - Developmental Biology 2021Quote: ... was performed using SYBR green based detection in a Biorad thermal cycler with MiRCURY LNA-based small RNA probes designed against 5’end of tRNA ArgCCT-2 (5‘GCCCCAGUGGCCUAAUGGAUAAGGCACUGGCC3’) with a polyA tail directed reverse miRCURY primer (Qiagen # 339317). U6 was used as an internal control (Qiagen # 339306).
-
bioRxiv - Cell Biology 2022Quote: ... ONTARGETplus Non-targeting siRNA oligo#1 (NT1) 5’-TGGTTTACATGTCGACTAA-3’ (Dharmacon, D-001810-01) and FlexiTube siRNA h USP31 oligo #1 (Q1) 5’-CCGAGTTCATGAAGACCTCAA-3’ (Qiagen, SI00758422), oligo #2 (Q2 ...
-
bioRxiv - Immunology 2022Quote: ... The middle and inferior right lobes were weighted and homogenized with PBS (1:5 w/v) using a 5 mm stainless steel bead (Qiagen, USA) and a TissueLyser LT (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... β-actin as housekeeping gene (Forward: 5’-CAGCCATGTACGTTGCTATCCAGG-3; reverse: 5’-AGGTCCAGACGCAGGATGGCA-3’) and 2X RT2 SYBR Green qPCR master mix (Qiagen, UK). The relative fold change in gene expression was analysed using the double delta Cq analysis (2-ΔΔCq ...
-
bioRxiv - Genomics 2019Quote: In order to screen for the presence of the Alu element in exon 4 of RP1 distinct pair of primers were designed (forward: 5′-AGGCTTGTTTCCTAGGAGAGGT-3′, reverse: 5′-TTCTGCTTCTTTTTCACTTAGGC-3′) using the CLCbio Genomics Workbench (Qiagen, Hilden, Germany).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 0.1 g of tissue per 1 mL of PBS was homogenized with stainless steel beads of 5 mm (25–30 Hz for 5 min) by a Tissuelyser (Qiagen, Venlo, Netherlands). The homogenates were centrifuged at 10,000 x g for 10 min and the supernatant was collected and stored at −80 °C until CD quantification ...
-
bioRxiv - Microbiology 2024Quote: ... and homogenized in groups of 3-5 flies by bead-beating with 3 x 5 mm stainless steel beads (Qiagen, Hilden, Germany) in 1 ml 1X PBS ...
-
bioRxiv - Plant Biology 2020Quote: ... at 65°C overnight and treated with 2 μg RNase A (Qiagen) for 1h at 37°C ...
-
bioRxiv - Neuroscience 2021Quote: ... 30s at 60°C on the Rotor-Gene Q 6-plex (QIAGEN). Mitochondrial copy number was calculated using the equation 2 × 2ΔCt ...
-
bioRxiv - Plant Biology 2021Quote: ... DNA samples were stored at -20°C in AE buffer from Qiagen DNeasy Plant Mini Kit.
-
bioRxiv - Biochemistry 2020Quote: ... Crystallization screening was performed at 4°C with JCSG core I (Qiagen) using the sitting drop vapor diffusion method ...
-
bioRxiv - Microbiology 2020Quote: ... for 3 hours at 37°C and purified using RNAeasy columns (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... using a TissueLyser (2 × 30 Hz, 3 min at 4°C; QIAGEN). After homogenization ...
-
bioRxiv - Neuroscience 2023Quote: ... at a frequency of 28/s @ 4°C (Tissue Lyser II, Qiagen). After this step the samples were adjusted to RT for 5 minutes and processed using the RNeasy Lipid Tissue Mini Kit (Qiagen ...
-
bioRxiv - Developmental Biology 2021Quote: ... we added a 5-mm stainless steel bead (QIAGEN) and 100 μl of PBS to each tube and lysed the samples by TissueLyser II (QIAGEN ...
-
bioRxiv - Genomics 2020Quote: ... 5 µL Proteinase-K (20 mg ml-1, Qiagen) was added to the solution and incubated at 60°C for 30 minutes ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 μg total RNA was treated with DNase (Qiagen) and purified (RNeasy Kit ...
-
bioRxiv - Cell Biology 2021Quote: ... A single sterile 5 mm stainless steel bead (Qiagen) was added to each tube ...
-
bioRxiv - Neuroscience 2022Quote: ... and added 5 volume PB including pH-indicator (Qiagen) and 200 μL sodium-acetate (3M ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.1 µl Hot Start Polymerase (Qiagen, 5 U/ µl), 20 ng/µl DNA template (95°C for 5 min ...
-
bioRxiv - Cell Biology 2022Quote: ... siWDR1 (5’-GGTGGGATTTAGGCAATTATT) and AllStars Negative Control siRNA (Qiagen).
-
bioRxiv - Cell Biology 2019Quote: ... Kif5b#4 (target sequence 5′-CACGAGCTCACGGTTATGCAA-3′; Qiagen SI00176057), and non-target (NT ...
-
bioRxiv - Cell Biology 2021Quote: ... 5’-ATGATCGATCATCTATAGCAA-3’ and 25nM S1PR1 #2 (Qiagen, #SI00376208) 5’-TAGCATTGTCAAGCTCCTAAA-3’ siRNAs or AllStars Negative Control siRNA (Qiagen ...
-
bioRxiv - Biochemistry 2021Quote: ... A 5 ml Strep-tactin Superflow Plus column (Qiagen) was equilibrated with 50 mM Tris-HCl pH 7.4 ...
-
bioRxiv - Molecular Biology 2021Quote: ... with a 5 mm diameter stainless steel bead (Qiagen) for a total of 6 min (2 x 3 min with 1 min on ice in between homogenisations ...