Labshake search
Citations for Qiagen :
901 - 950 of 10000+ citations for C Reactive Protein CRP ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Dimeric prion protein ligand activates Adgrg6 but does not rescue myelinopathy of PrP-deficient micebioRxiv - Neuroscience 2020Quote: ... The temperature was increased from 25 °C to 95 °C at 3 °C per minute and fluorescence was measured at 610 nm in a Rotor-Gene Q thermocycler (Qiagen). The experiment was performed in technical triplicates ...
-
bioRxiv - Molecular Biology 2019Quote: ... were frozen at −80°C and subsequently digested at 56°C overnight by Proteinase K (10mM in Tris-HCl, 19133, Qiagen). To account for potentially differential cell proliferation rate between treatments all the ATP quantifications were normalized to DNA content in the same samples ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was extracted from homogenates after overnight incubation with 20 μl of proteinase K at 56°C using the QIAamp DNA Micro Kit (Qiagen, Hilden, Germany, cat. No. 56304) following the manufacturer’s protocol for tissue samples ...
-
bioRxiv - Immunology 2023Quote: ... The remaining cells were pelleted by centrifugation (4000rpm, 30min, 4C) and stored at –20°C for bulk EEV extraction by endotoxin-free maxiprep (Qiagen EndoFree Maxi Kit, Cat. 12362).
-
bioRxiv - Genomics 2019Quote: ... and stored at −20°C until midiprepped (Qiagen) according to the manufacturer’s protocol.
-
bioRxiv - Immunology 2021Quote: ... cDNA was quantified using 96-well PCR array analysis on a PAMM-150ZA plate (Cytokines & Chemokines) and PAMM-016ZA plate (Type I Interferon Response) (both Qiagen). Quantitative real time-PCR (QRT-PCR ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The tube was then fitted in a 96-well storage plate and secured between the top and bottom plates of TissueLyser II (QIAGEN). The components were then mixed for 10 seconds at 15 Hz followed by 7 seconds at 17 Hz ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The tube containing the two phases was then fitted in a 96-well storage plate and secured between the top and bottom plates of TissueLyser II (QIAGEN). The components were then mixed for 10 seconds at 15 Hz followed by 7 seconds at 17 Hz ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The tube containing the two phases was then fitted in a 96-well storage plate and secured between the top and bottom plates of TissueLyser II (QIAGEN). The components were then mixed for 10 seconds at 15 Hz followed by 7 seconds at 17 Hz ...
-
bioRxiv - Genomics 2020Quote: ... 25 nuclei were sorted into each well of 96-well plates (8-10 plates per experiment) containing 12 µl of nuclear lysis buffer (11 µl of EB buffer (Qiagen) supplemented with 0.5 µl of 100X BSA and 0.5 µl of 1% SDS) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and protein extraction were performed according to manufacturer instructions (AllPrep DNA/RNA/Protein minikit; Qiagen). Each spin column flowthrough (DNA ...
-
bioRxiv - Microbiology 2023Quote: ... The His-tagged proteins were purified using the QIAexpress Ni-NTA Protein Purification System (Qiagen) with 0.1 M ...
-
bioRxiv - Physiology 2022Quote: ... Using the Neuronal ion channel plate (Qiagen, UK), 84 ion channels as well as housekeepers were measured in each sample ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and released into a PyroMark Q24 plate (Qiagen) pre-loaded with 0.3μM of sequencing primer ...
-
bioRxiv - Genetics 2023Quote: ... plates were shaken on a TissueLyser II (Qiagen) at 900 rpm (15 rps ...
-
bioRxiv - Synthetic Biology 2024Quote: ... of Gibson Assembly reaction mix was added to NEB Stbl cell (C3040) for transformation and grown at 30°C or 37°C for the plasmid DNA preparation (Qiagen miniprep). The resulting plasmids were sequence-verified using Sanger sequencing (Genewiz).
-
bioRxiv - Microbiology 2019Quote: ... Reactions were run in a total volume of 10 μl having 5 μl Rotor-Gene SYBR® Green PCR Kit (Qiagen, NSW, Australia), 0.3 μl each of 10 μM forward and reverse primer and 2 μl of genomic DNA ...
-
bioRxiv - Plant Biology 2021Quote: ... and sunflower_KTI _R (5’ – CTACTCAGATTGAACAGAAGCCAC- 3’were designed and used in a PCR reaction with total DNA extracted (DNeasy Plant Mini Kit, Qiagen, Valencia CA USA) from sunflower leaf tissue ...
-
bioRxiv - Microbiology 2021Quote: ... Intact bacterial cells were pelleted by centrifugation at 10,000 x g for 5 min at room temp and DNA extracted from the pellet using a DNeasy® Blood & Tissue kit (Qiagen, Hilden, Germany). DNA concentration was assessed by the QubitTM dsDNA BR Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2021Quote: ... we pooled 1.5 mg RNA from each sample (mixed-stage, male-enriched, and starved) and used the RNeasy MinElute Cleanup kit (Qiagen, catalog no. 74204) to further purify and concentrate the pooled RNA ...
-
bioRxiv - Immunology 2022Quote: ... Cells were centrifuged for 5 minutes at 300xg and pellets resuspended in Buffer RLT Plus (RNeasy Plus Mini Kit from Qiagen, Germantown, MD, USA), and frozen at −80°C ...
-
bioRxiv - Neuroscience 2023Quote: ... The left hippocampus was homogenized on ice in the lysis buffer from the AllPrep® DNA/RNA/Protein Mini Kit (QIAGEN, Hilden, Germany). A sample from the lysate was used to quantify total DNA and RNA content using the appropriate Qubit® Fluorometer kit (Cat ...
-
bioRxiv - Plant Biology 2020Quote: ... The expressed protein was purified as His-tagged fusion protein using Ni-NTA agarose beads (Qiagen) and analyzed by SDS-PAGE.
-
bioRxiv - Developmental Biology 2021Quote: ... One 5 mm ∅ metal bead (Qiagen) and 500 µl Qiazol (Qiagen ...
-
bioRxiv - Developmental Biology 2021Quote: ... One 5 mm ∅ metal bead (Qiagen) and 500 µl Qiazol (Qiagen ...
-
bioRxiv - Biochemistry 2019Quote: ... 5 μL of Ni-NTA (Qiagen) slurry was added and the solution was incubated with light agitation at 4 °C for 50 min ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... 5 μL Qiagen master mix (Qiagen Type-It Microsatellite Kit ...
-
BCR analysis of single-sorted, putative IgE+ memory B cells in food allergy: an ephemeral existence?bioRxiv - Immunology 2019Quote: ... 5 μL 10X PCR buffer (Qiagen), and nuclease-free water to a final volume of 50 μL ...
-
bioRxiv - Cell Biology 2021Quote: ... si-FAU (5’-CCGGCGCUUUGUCAACGUUGU-3’, Qiagen), si-uS19 (5’-UCACCUACAAGCCCGUAAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-eS4X (5’-CUGGAGGUGCUAACCUAGGAA-3’, Qiagen), si-FAU (5’-CCGGCGCUUUGUCAACGUUGU-3’ ...
-
bioRxiv - Genomics 2021Quote: ... containing 5 µl RLT plus (Qiagen) with 1% v/v β-mercaptoethanol (Biorad) ...
-
bioRxiv - Developmental Biology 2023Quote: ... with one 5 mm (Qiagen, 69989) and three 2.8 mm metal beads (Precellys ...
-
bioRxiv - Cell Biology 2023Quote: ... #4: 5’-CCGGTTTAGCTGAAGATTCAA-3’ (SI00443779, Qiagen), GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647 ...
-
bioRxiv - Cell Biology 2023Quote: ... #3: 5’-AAGCATCGATAGGTAAGTTGA-3’ (SI03130008, Qiagen); #4 ...
-
bioRxiv - Immunology 2021Quote: ... Serum was stored at −80°C as well as tissue samples were stored at −80°C or in RNAlater (Qiagen, Hilden, Germany) at −20°C.
-
bioRxiv - Physiology 2020Quote: ... protein was extracted (Qiagen Tissue Lyser) from ∼50 mg frozen liver in tissue lysis buffer 80 ...
-
bioRxiv - Microbiology 2021Quote: ... 200 μL Protein Precipitation Solution (QIAGEN) was added ...
-
bioRxiv - Microbiology 2023Quote: ... and The Protein Complex Suite (Qiagen). One microliter of 4.6 mg/ml protein sample suspended in crystallization buffer (25 mM Tris-HCl ...
-
bioRxiv - Cancer Biology 2023Quote: Advanced Protein Purification buffer (APP; Qiagen): the APP buffer contains zinc chloride to precipitate protein at room temperature ...
-
bioRxiv - Cancer Biology 2021Quote: ... PCOs were stored at -80°C in RNAlater (Qiagen) until library preparation ...
-
bioRxiv - Molecular Biology 2023Quote: ... and further disrupted by TissueLyser II (QIAGEN, C.0659). 100 mg ground sample was first resuspended in 1 mL lysis buffer (1×PBS ...
-
bioRxiv - Evolutionary Biology 2019Quote: We extracted whole genomic DNA from 5 individuals per line using a Qiagen® DNEasy Blood and Tissue Kit (Qiagen, Inc., Valencia, CA, USA), following a modified version of the mouse-tail protocol ...
-
bioRxiv - Genetics 2022Quote: ... 5 μl of each sample was pooled into one of 5 indexed libraries and PCR purified using a QIAquick PCR Purification Kit (Qiagen, Inc., Valencia, CA, USA). Prior to preparing individuals for next generation sequencing ...
-
bioRxiv - Biochemistry 2019Quote: ... Reactions were quenched at different time points (2, 5, 7, 10 and 20 minutes) by the addition of 250 μL of PB buffer (Qiagen QIAquick PCR Purification Kit) supplemented with 10 mM of EGTA ...
-
bioRxiv - Microbiology 2019Quote: ... with two sets of 96-well adapter plates (QIAGEN) containing 2 ml microcentrifuge tubes (QIAGEN ...
-
bioRxiv - Cancer Biology 2020Quote: ... The plate was loaded with a QIAgility Robot (Qiagen) and run on 7500 Fast Real-Time PCR System (ThermoFisher ...
-
bioRxiv - Microbiology 2023Quote: ... EasyXtal 15-well Tool crystal plates (Qiagen, Manchester, UK) were set up manually for HAdV-D15 ...
-
bioRxiv - Biochemistry 2024Quote: ... co-expressing lambda protein phosphatase and purified with the QIAexpress Ni-NTA Protein Purification System (Qiagen, 30210) according to the manufacturers protocol ...
-
bioRxiv - Genomics 2022Quote: ... converted DNA was amplified using primers Fwd 5’ TTGATGGAGTAAAAGGAATTGTTTTAGG and Rev 5’ CCAATTCAAAAATTTAAAAAAAACAAAACC with HotStarTaq DNA Polymerase (QIAGEN). The PCR conditions were ...
-
bioRxiv - Cancer Biology 2023Quote: ... tumors were mechanically dissociated in lysis buffer and total RNA was extracted using the AllPrep DNA/RNA/protein mini Kit (Qiagen, USA, Cat. No. / ID: 80004) according to the manufacturer’s protocol ...