Labshake search
Citations for Qiagen :
1001 - 1050 of 4373 citations for 3 4 Hydroxy 5 isopropyl 6 oxo 1 6 dihydro pyrimidin 2 ylsulfanyl propionic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue microregions were deposited with 2 µl PBS into PCR tubes containing 18 µl of lysis buffer: 1:16 mix of Proteinase K solution (QIAGEN) in PKD buffer (QIAGEN) ...
-
bioRxiv - Immunology 2021Quote: ... A total of 1-2 μg of RNA was used to synthesize the first single-strand cDNA using QuantiTect Reverse Transcription kit (Qiagen). For RT-PCR amplification ...
-
bioRxiv - Genomics 2021Quote: We began the assembly by first mapping long reads to the S288c reference genome (version R64-2-1) using CLC Genomics Workbench (Qiagen)(Fig ...
-
bioRxiv - Immunology 2020Quote: RNA was isolated from individual pools of 1×104 to 2×104 double-sorted SLAM cells using an RNEasy Micro kit (Qiagen). RNA was quantified and quality checked using an Agilent Bioanalyzer 2100 (Agilent) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 50uL of the dounce homogenized sample was labelled as “input” and added to 350uL RLT buffer with 1% 2-mercaptoethanol (Qiagen), followed by RNA extraction ...
-
bioRxiv - Biochemistry 2021Quote: ... and early stationary phase (OD = 1.0-1.3).1 mL sample of each culture was directly transferred to 2 mL RNAprotect cell reagent (Qiagen, Hilden, Germany). The samples were vortexed 5 sec ...
-
bioRxiv - Immunology 2022Quote: Total RNA was prepared from 1-2*106 sorted naïve (CD25− CD44lowCD62high) or effector (CD25− CD44highCD62low) CD4+ T-cells using RNeasy Mini Kit (Qiagen Inc.) as described in manufacturer’s protocol including an on-column digestion step (RNaseFree DNase Set ...
-
bioRxiv - Neuroscience 2024Quote: ... DRG and paw skin RNA was extracted using a RLT buffer:2-mercapto ethanol mixture in a 100:1 ratio/RNeasy (Qiagen) RNA mini kit according to the manufacturer’s instructions and spinal cord and spleen RNA was extracted using TRizol (Invitrogen)/RNeasy RNA mini kit ...
-
bioRxiv - Microbiology 2024Quote: ... mixed with 1 mL phenol:chloroform:isoamyl alcohol (25:24:1 at pH 8) at 70°C for 12 min and bead beating for 2 min (Tissue Lyser II, Qiagen). The mixture was centrifuged at 4°C for 3 min at maximum speed and the aqueous phase was transferred to a new reaction tube ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were directly lysed in the well using 350 µL of lysing solution (1% 2-mercaptoethanol in Buffer RLT; RNeasy Mini Kit, 74106, Qiagen) by pipetting over the well ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA (2 μg per sample) extracted from 1×106 BSCs was performed using the Qiagen RNA RNeasy Kit (Cat#74104, Qiagen) followed by library preparation with the Illumina TruSeq V2 Kit (Cat#20020594 ...
-
bioRxiv - Genomics 2022Quote: ... RNA (3 replicates each of V or E2 treated samples from donor 1 and donor 2) was DNAse treated and cleaned up using the RNeasy Mini kit (Qiagen) or the RNA Clean and Concentrator 5 kit (Zymo ...
-
bioRxiv - Microbiology 2024Quote: ... The footpad was ground in 1 mL of DMEM containing 2% FBS with steel beads using a Tissue-Lyser II (Qiagen) and debris was clarified by centrifugation at 8,000 x g for 10 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... Faeces was collected in pre-weighed tubes containing 1 ml PBS and homogenised with a steel ball for 2 minutes at 25 Hz using a Tissue-Lyser (Qiagen). Mice were euthanised at indicated time-points ...
-
bioRxiv - Genomics 2024Quote: ... Bxb1 integrase-edited Rep 1 and Rep 2 K562attB gDNA genomic DNA was extracted using DNeasy blood and tissue kit (Qiagen) and samples library preparation and Illumina short read sequencing with a target of 60x genomic coverage ...
-
bioRxiv - Molecular Biology 2024Quote: ... and HET(2)) and four biological replicates of PA-1 (WT and HET) cells was extracted using miRNeasy Mini Kit (Qiagen) followed by on-column DNAse digestion ...
-
bioRxiv - Plant Biology 2024Quote: ... Reverse transcription of 1–2 μg of RNA for cDNA synthesis was carried out using the Omniscript RT Kit (Qiagen).
-
bioRxiv - Genetics 2024Quote: ... 20 µM of Illumina primers and 1:2000 dilution of 2 ng/µl library on Rotor-Gene Q machines (Qiagen), program and primer sequences are in Table) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 3 µg pINDUCER20-GFP-AFOS using PolyFect (Qiagen, 301107). Media was collected at 48 and 72 hours post-transfection and viral particles were precipitated using PEG-it™ Solution (System Biosciences ...
-
bioRxiv - Plant Biology 2022Quote: ... Hoko-3 using a Genomic-tip kit (Qiagen, Hilden, Germany). Library preparation was performed using SMRTbell Express Template Prep Kit 2.0 (PacBio ...
-
bioRxiv - Biochemistry 2023Quote: ... and mixed with 3 mL of Ni-NTA resin (Qiagen) for 1.0 h at 4 °C and then applied to a gravity flow column ...
-
bioRxiv - Molecular Biology 2024Quote: ... were crushed with a tungsten carbide bead (3 mm, Qiagen) on a Retsch MM400 mixer mill for 60 seconds at 30 Hz and DNA was extracted using the DNeasy Plant Mini kit (Qiagen) ...
-
bioRxiv - Genetics 2022Quote: ... The tissue powder was then transferred to a 1.5 mL centrifuge tube where 400 μL of 1% PVP-40 Buffer AP1 solution and 4 μL of RNase A were added (Qiagen DNeasy Plant Kit Qiagen Inc, Hilden, Germany). The tube was initially vortexed to homogenize the solution before incubation at 65 °C for 30 minutes with a short vortex every 5 minutes.
-
bioRxiv - Molecular Biology 2023Quote: ... genomic DNA from 10 adult flies (5 males/5 females) was extracted using DNeasy Blood & Tissue Kit (Qiagen). DNA was resuspended and sheared in 1X TE (0.1 mM EDTA ...
-
bioRxiv - Genomics 2022Quote: ... converted DNA was amplified using primers Fwd 5’ TTGATGGAGTAAAAGGAATTGTTTTAGG and Rev 5’ CCAATTCAAAAATTTAAAAAAAACAAAACC with HotStarTaq DNA Polymerase (QIAGEN). The PCR conditions were ...
-
bioRxiv - Synthetic Biology 2024Quote: ... an aliquot (5 µL) was treated with 0.5 µL of 5 mg/ml RNase A (QIAGEN, Hilden, Germany) at 37 °C for 30 min ...
-
bioRxiv - Genetics 2020Quote: ... 5 µl Multiplex PCR Master Mix (QIAGEN), 0.2 µM of M13-tailed forward primer ...
-
bioRxiv - Immunology 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Genomics 2020Quote: ... 5 μl of RLT plus buffer (QIAGEN) and 60 fg of λ-DNA were added into each isolated nucleus to lyse nucleus completely ...
-
bioRxiv - Immunology 2021Quote: ... 5 ml packed Ni-NTA resin (Qiagen) were equilibrated in lysis buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl RT primers ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 mm stainless steel beads (Qiagen). Phase separation was done by mixing 100 μl of Chloroform followed by centrifugation at 12000xg for 15 min in 4°C ...
-
bioRxiv - Immunology 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5 mm stainless steel beads (Qiagen). Sections were homogenized using a tissue lyser (Qiagen ...
-
bioRxiv - Neuroscience 2020Quote: ... Custom 5’ DIG labeled LNA probes (Qiagen) are as follows ...
-
bioRxiv - Immunology 2020Quote: ... or a 5 mm steel ball (Qiagen). For tissues ...
-
bioRxiv - Genetics 2020Quote: ... using 5 mm stainless steel bead (Qiagen) at 20 Hz for 4 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... 5 volumes of PB Buffer (Qiagen 28004) were added ...
-
bioRxiv - Immunology 2021Quote: ... using 5 mm stainless steel beads (Qiagen). RNA was extracted by the chloroform/isopropanol method and converted to cDNA as previously described ...
-
bioRxiv - Biochemistry 2023Quote: ... with 5 mm stainless steel beads (Qiagen) at 30 Hz for 3 min at 4°C ...
-
bioRxiv - Cell Biology 2023Quote: ... using 5 mm stainless steel beads (Qiagen) for 4 minutes at 24,000 rpm ...
-
bioRxiv - Microbiology 2024Quote: ... using stainless steel beads (5 mm; Qiagen). RNA was then extracted using a RNeasy Mini kit (Qiagen) ...
-
bioRxiv - Neuroscience 2024Quote: ... using 5-mm stainless steel beads (Qiagen) at 25 Hz for 1.5-3min (Qiagen/Retsch Bead Beater) ...
-
bioRxiv - Neuroscience 2024Quote: ... using 5-mm stainless steel beads (Qiagen) at 25 Hz for 1.5-3min (Qiagen/Retsch Bead Beater) ...
-
bioRxiv - Genetics 2023Quote: ... 5 ul of 5X Q-solution (Qiagen), 1 ul of 5 mM 7-deaza-dGTP (NEB) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and 5-mm stainless steel beads (Qiagen) at 25 Hz for 1.5-3 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNAse A (5 μg/mL, Qiagen #19101) was added to the whole cell extracts (WCE ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2.7 × 10−5 AU/mL protease (Qiagen), 1.0 μM barcoded oligodT-ISPCR primer ...
-
bioRxiv - Microbiology 2023Quote: ... 5 mm diameter stainless steel bead (Qiagen) was added to all the tubes and the tissue was homogenised in TissueLyser II (Qiagen ...
-
bioRxiv - Cancer Biology 2023Quote: ... and stainless-steel beads (5 mm, Qiagen) before RNA isolation using the AllPrep DNA/RNA/Protein Mini Kit (Qiagen ...