Labshake search
Citations for Qiagen :
851 - 900 of 4373 citations for 3 4 Hydroxy 5 isopropyl 6 oxo 1 6 dihydro pyrimidin 2 ylsulfanyl propionic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... Recombinant proteins were affinity purified using nickel-nitrilotriacetic acid (Ni-NTA) agarose (Qiagen) and elution with imidazole ...
-
bioRxiv - Genomics 2021Quote: ... Nucleic acids were extracted using a QIAGEN DNeasy (DNA) kit (Qiagen Hilden, Germany). Three de novo genome sequencing methods were performed on the liver fluke ...
-
bioRxiv - Microbiology 2022Quote: Nucleic acids were extracted from samples using a DNeasy PowerSoil kit (Qiagen, Germany) and quantified using the Quant-IT PicoGreen assay kit (Invitrogen ...
-
bioRxiv - Physiology 2020Quote: ... DNA from plasma was extracted with the QIAamp Circulating Nucleic Acid Kit (Qiagen).
-
bioRxiv - Genomics 2021Quote: ... Amino acid sequences were aligned using CLC Genomics Workbench 20.0.04 (QIAGEN, Aarhus, Denmark).
-
bioRxiv - Genomics 2021Quote: Nucleic acids were extracted by homogenizing tissues using a TissueLyser II (Qiagen, 85300) followed by the AllPrep DNA/RNA/miRNA Universal Kit (Qiagen ...
-
Epigenetic alterations underlie airway macrophage differentiation and phenotype during lung fibrosisbioRxiv - Immunology 2020Quote: Nucleic acids were extracted from cells using the AllPrep Mini Kit (QIAGEN, Germany). DNA quality and quantity were assessed using Genomic DNA ScreenTape and TapeStation System (Agilent ...
-
bioRxiv - Genomics 2020Quote: ... Chondrocytes were transfected in duplo with antisense locked nucleic acid (LNA) GapmeR (Qiagen) targeting P3H2-AS1 (TGAGCAACTAGGTGTA ...
-
bioRxiv - Cell Biology 2021Quote: ... The soluble recombinant protein was purified using theNickel-Nitrilotriacetic acid (Ni-NTA+; Qiagen) resin ...
-
bioRxiv - Cancer Biology 2023Quote: ... all proteins were purified using Ni-NTA (nickel-nitrilotriacetic acid) resin from QIAGEN. After the incubation of Expi293 media supernatant with the Ni-NTA resin ...
-
bioRxiv - Cell Biology 2023Quote: ... The proteins were first purified using nickel-nitrilotriacetic acid (NTA) agarose resin (Qiagen), and the His8-SUMO tag was then removed by TEV protease (10:1 w/w ...
-
bioRxiv - Microbiology 2023Quote: ... viral nucleic acids were extracted using the QIAamp Viral RNA Mini Kit (QIAGEN GmbH ...
-
bioRxiv - Microbiology 2023Quote: ... Bacterial nucleic acid was extracted using the EZ1 DNA tissue kit (Qiagen, Germany) on EZ1 Advanced XL (Qiagen ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was incubated with Ni-nitrilotriacetic acid (Ni-NTA) resin (Qiagen, Germany) on a rocker for 1 hour at 4 °C ...
-
bioRxiv - Immunology 2024Quote: ... resuspended in 500 µL ribonucleic acid (RNA) protect bacterial reagent (Qiagen, Cat. # 76506), allowed to incubate at room temperature for 10 minutes followed by centrifugation at 5,000 x g for 10 minutes ...
-
bioRxiv - Immunology 2024Quote: ... nucleic acid was extracted from cells or tissues using DNeasy mini kit (Qiagen). HIV-1 DNA was quantified by real-time PCR ...
-
bioRxiv - Cancer Biology 2024Quote: Locked nucleic acid GapmeR antisense oligonucleotides (LNA ASOs) targeting LINC01432 (Qiagen, cat# 3653410) and CELF2 (Qiagen ...
-
bioRxiv - Biophysics 2024Quote: ... Affinity purification was performed using nickel nitriloacetic acid (Ni-NTA) affinity column (Qiagen) attached to an AKTA™ start system (Cytiva) ...
-
SARS-CoV-2 comprehensive receptor profiling: mechanistic insight to drive new therapeutic strategiesbioRxiv - Cell Biology 2021Quote: ... each pre-incubated at a 2:1 molar ratio with Penta His Alexa Fluor 647 Conjugate (Qiagen, UK). Hits (duplicate AF647 positive spots ...
-
bioRxiv - Plant Biology 2020Quote: ... The clear supernatant was then gently mixed with 1 ml of Ni+2-NTA agarose beads (Qiagen, Germany) for 30 min and then added to the column with a flow rate of 0.5 ml/min ...
-
bioRxiv - Immunology 2022Quote: ... diluted in Milli-Q H2O 1:2 and the cells disrupted by mechanical lysis in the TissueLyser (Qiagen) for 2 minutes at 30 Hz and three freeze/thaw cycles (20° to -20°C).
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
bioRxiv - Immunology 2020Quote: ... Pellets were lysed by vortexing for 1 minute in 350uL cold supplemented RLT buffer (RLT + β-MeOH) at 4°C and lysates homogenized using QIAshredder columns (Qiagen). RNA was then extracted from these samples using the RNeasy Plus Micro kit (Qiagen ...
-
bioRxiv - Cancer Biology 2022Quote: ... after which we select the top 250 genes for which the correlation coefficient was positive and the top 250 genes for which the correlation coefficient was negative. The final step of the pipeline (Fig. 1 (4)) analyzes these genes by using Ingenuity Pathway Analysis (IPA, QIAGEN, [27]) to interpret the canonical pathways.
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2023Quote: ... 0.5μl of diluted cDNA (1:3 - nuclease-free water) was used as template in 10μl real-time PCR reactions (Qiagen: ‘SYBR Green PCR kit’) to assay specific transcripts (BioRad ...
-
bioRxiv - Genomics 2022Quote: 4 μL of Vapor-Lock (QIAGEN, 981611) was manually dispensed into each well of a 384-well plate using a 12-channel pipette ...
-
bioRxiv - Genetics 2024Quote: ... 4 µL RNase (QIAGEN, Venlo, The Netherlands) was added ...
-
bioRxiv - Immunology 2024Quote: ... containing 4 IU/ul DNAseI (Qiagen, 79254) and 1 IU/ul RNAseq inhibitor (Recombinant RNAsin ...
-
bioRxiv - Cell Biology 2024Quote: ... with 4 µg/mL DNase (79254, Qiagen) at 37 °C for 15-20 min ...
-
bioRxiv - Microbiology 2022Quote: ... A wild-type virus stock NL4-3 was prepared by transfection of the pNL4-3 plasmid (purified using the Qiagen Plasmid Maxikit) into HeLa cells ...
-
bioRxiv - Genomics 2021Quote: ... Total RNA was isolated from the VTM in a biosafety level-3 (BSL-3) laboratory using QIAamp viral RNA mini kit (Qiagen, Hilden, Germany) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... a volume equivalent to 5×108 cells were spun down (assuming 1 OD600=8×108 cells) and Protect Bacteria RNA Mini Kit (Qiagen) was used to extract total RNA as described in (Bhattacharyya et al. ...
-
bioRxiv - Systems Biology 2021Quote: ... 0.5-1 μg of total RNA was reverse transcribed into first-strand cDNA using an RT2 First Strand Kit (QIAGEN). The resultant cDNA was subjected to qPCR using human cytokine-specific primer (Realtimeprimers.com ...
-
bioRxiv - Microbiology 2021Quote: ... The digested DNA was separated on a 1% agarose gel and the ∼5 Kb genomic DNA band was harvested with a QIAquick Gel Extraction Kit (Qiagen). The DNA library was prepared according to the manual of the Ligation Sequencing Kit (Nanopore) ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were lysed by boiling (5 min 95°C) followed by bead beating (3mm beads, 30 Hz for 1 min) (TissueLyser II, Qiagen) and sonication bath (3×10 sec at 4°C ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... several loci were amplified simultaneously from 1 μl of extracted DNA using 5 μl of the Multiplex PCR Master Mix (Qiagen) and varying amounts of the pooled primer mixes (Pool A ...
-
bioRxiv - Microbiology 2021Quote: ... samples were weighed and homogenized in DMEM containing 10% FBS and 1% antibiotics using 5 mm stainless steel beads (Qiagen) and the TissueLyser II (Qiagen) ...
-
bioRxiv - Genomics 2023Quote: ... The bead-bound gDNA was isothermally amplified for 3 hours at 30 °C then 10 minutes at 65 °C using a miniaturised (1/5 vols) Repli-g Single-Cell assay (Qiagen). The amplified gDNA was cleaned up with 0.8 × vols Ampure XP and 80 % ethanol ...
-
bioRxiv - Microbiology 2023Quote: ... Metagenomic sequencing libraries were constructed from extracted DNA samples with 10 μL (1/5 volume) reactions using the QIAseq FX DNA Library Kit (QIAGEN). Each metagenomic sequencing library was sequenced using the Illumina NextSeq 2000 System 2 x 150 bp configuration.
-
bioRxiv - Molecular Biology 2023Quote: cDNA was produced from 1 μg of total RNA (final cDNA concentration 5 ng/ml) using QuantiTech Reverse Transcription kit (Qiagen) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2022Quote: ... and homogenized twice for 1-5 minutes each at 25Hz using a TissueLyser LT sample disruptor (Qiagen, Part No. 85600) with a 12 tube Tissue Lyser LT adapter (Qiagen ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA was extracted from input and IP samples by incubation with 1 mL Trizol at room temperature for 5 minutes and then RNeasy Lipid Tissue Mini Kit (Qiagen) via the manufacturer’s protocol with on-column DNase treatment (Roche) ...
-
bioRxiv - Plant Biology 2022Quote: ... using 3-mm steel beads (Cat No.: 69997, Qiagen); tubes were shaken for 20-s at 28 Hz with dry ice.
-
bioRxiv - Evolutionary Biology 2022Quote: ... with two sterile 3 mm beads (Qiagen, Hilden, Germany) and a bead device at 20 Hz for 3 min ...
-
bioRxiv - Immunology 2020Quote: ... and prepared the QIAseq UPX 3’ Transcriptome Kit (QIAGEN). 10ng purified RNA was used for the NGS libraries ...
-
bioRxiv - Microbiology 2020Quote: ... cells were lysed in 3 volumes RLT buffer (Qiagen) and RNA was extracted using Dynabeads MyOne Silane (Life technologies) ...
-
bioRxiv - Biochemistry 2021Quote: ... using a TissueLyser II (3 min, 30 Hz; Qiagen). After vigorous mixing with chloroform at a 1:4 v/v ratio (chloroform:TRIzol) ...
-
bioRxiv - Genomics 2021Quote: ... 3 μl of nuclease free water (Qiagen, Hilden, Germany) and 5 μl of template containing cDNA ...