Labshake search
Citations for Qiagen :
51 - 100 of 1491 citations for 3 2 Methylphenoxy methyl piperidine hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... or a non-targeting scrambled control (Scr; sequence: 5’-TAACACGTCTATACGCCCA-3; Qiagen, Cat No.: 339137; 0.1 nmol in 2 μL PBS), using a 2 μL Hamilton syringe at a rate of 1 μL/min ...
-
bioRxiv - Microbiology 2024Quote: Total RNA of the supernatants collected from SARS-CoV-2 infected Calu-3 cells 48 h post-infection were isolated using the QIAamp Viral RNA Mini Kit (Qiagen; #52906) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: Total RNA was extracted from hESCs approximately 52 hr (day 2) or 74 hr (day 3) after starting the cardiac differentiation protocol using the RNeasy Mini Kit (QIAGEN 74106) from at least two independent biological replicates per sample ...
-
bioRxiv - Developmental Biology 2024Quote: ... and agarose gel electrophoresis from genomic DNA isolated 2-3 days after electroporation using the DNeasy Blood & Tissue Kit (Qiagen 69506). 24 hr after electroporation ...
-
bioRxiv - Molecular Biology 2021Quote: ... EpiTect II DNA Methylation Enzyme Kit (335452) and EpiTect methyl II PCR system (EPMM104707-1A) for CpG methylation analysis was procured from Qiagen. [γ-32P]ATP was sourced from
-
bioRxiv - Genomics 2023Quote: ... The samples were processed with Ovation RRBS Methyl-Seq System (NuGen) and bisulfite treatment was done with the Epitect Fast Bisulfite Conversion kit (Qiagen). RRBS libraries were controlled with a BioAnalyser (Agilent ...
-
bioRxiv - Developmental Biology 2024Quote: ... thresholds were used to prepare Reduced Representation Bisulfite Sequencing (RRBS) libraries using the Ovation RRBS Methyl-Seq System 1-16 (NuGen) and the EpiTect Fast DNA Bisulfite kit (Qiagen). Libraries were sequenced using the NextSeq500 platform (Illumina ...
-
bioRxiv - Biochemistry 2020Quote: ... resuspended in buffer A supplemented with 8 M guanidine hydrochloride (= buffer B) and loaded onto an Ni-NTA agarose column (QIAGEN) pre-equilibrated in the same buffer ...
-
bioRxiv - Immunology 2021Quote: ... RNA from each Xenopus embryo (n=2-3/condition) was separately extracted and purified using the RNeasy Micro Kit (Qiagen; Venlo, Netherlands) and microarray measurements were performed using the GeneChip Xenopus laevis Genome 2.0 Array (Affymetrix ...
-
bioRxiv - Plant Biology 2022Quote: ... Tissue was ground to a fine powder at −80°C using 3-mm stainless steel beads at 50 Hz for 2*30 seconds in a TissueLyser LT (Qiagen, Germantown, USA). Ground samples were extracted with 1 mL of cold methanol containing [phenyl 13C6]-IAA (0.1 nmol/mL ...
-
bioRxiv - Cell Biology 2022Quote: Genomic DNA was extracted from 2×105 primary human lung fibroblasts harvested in passage 3 using QIAamp Micro Kit (Qiagen, Hilden, Germany) following manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... Tissue was ground to a fine powder at −80°C using 3-mm stainless steel beads at 50 Hz for 2*30 seconds in a TissueLyser LT (Qiagen, Germantown, USA). Ground samples were extracted with 1 mL of cold methanol containing [phenyl 13C6]-IAA (0.1 nmol/mL ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... we homogenized 2-3 fecal pellets in 1 mL H2O using ceramic beads (NucleoSpin, Macherey–Nagel, Dueren, Germany) and a TissueLyser (Qiagen, Hilden, Germany), mixing the sample for 3 × 30 s at 4,500 rpm with a 10 s cooling break (< 0°C) ...
-
bioRxiv - Plant Biology 2023Quote: ... Collected tissue was ground to a fine powder at -80°C using 3 mm stainless steel beads at 50 Hz for 2*30 seconds in a TissueLyser LT (Qiagen, Germantown, USA), and between 10-15 mg of ground tissue per sample was used for auxin extraction ...
-
bioRxiv - Developmental Biology 2021Quote: ... single-end BS-seq libraries were also constructed with Ovation Ultralow Methyl-Seq Library Systems (Nugen, 0336) and EpiTect Bisulfite Kit (Qiagen, 59104) kits according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... Further confirmation of which allele was deleted in clones with only one UBE3A copy was performed by utilizing the EpiTect Methyl II DNA Restriction Kit (QIAGEN, #335452) to measure methylation at the PWS-IC (SNRPN ...
-
bioRxiv - Genetics 2020Quote: ... we split the 50 μl reaction volume into two and we added 25 μl of guanidine hydrochloride (Buffer PB, Qiagen 28606) to each as a chaotropic agent to stop the reaction and dissociate the proteins and transposase from the DNA ...
-
bioRxiv - Neuroscience 2024Quote: ... Inclusion bodies were solubilized in 8 M guanidine hydrochloride (GdnHCl) and then PrP was captured using Ni-NTA Superflow beads (Qiagen #30410). Bead-bound PrP was refolded on-column using a 4 h gradient from 6 to 0 M GdnHCl and then eluted using a gradient from 0 to 500 mM imidazole ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-TGGTTCTACATCAGAGTTGTT-3’ (Qiagen). Lentiviral particles expressing SMART vectors doxycyclin-inducible shRNA were from Dharmacon as follows ...
-
bioRxiv - Genomics 2020Quote: ... DNA was extracted from peripheral blood leukocyte samples from visit 2 or 3 using the Gentra Puregene Blood Kit (Qiagen; Valencia, CA, USA) according to the manufacturer’s instructions (www.qiagen.com ...
-
bioRxiv - Genomics 2024Quote: ... Then the total volume was spun down and plasmid pools were extracted from the bacterial pellets using 2-3 columns of the Hi-Speed Plasmid Maxiprep kit (Qiagen, catalog no. 12663) per sublibrary ...
-
bioRxiv - Physiology 2020Quote: ... Erythrocytes were lysed for 3 minutes with 3 ml of EL buffer (Qiagen). After Fc blocking for 20 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3’mRNA-seq libraries were prepared using QIAseq UPX 3’ Transcriptome Kit (QIAGEN). In brief ...
-
bioRxiv - Bioengineering 2024Quote: ... the 3×Flag-MCS fragments in LV3-SFFV-3×Flag-MCS-GFP (QZ35395, QIAGEN) was replaced by DreAM though NotI and SpeI sites to produce the LV3-SFFV-DreAM-GFP plasmid ...
-
bioRxiv - Cell Biology 2021Quote: ... siMad2 (5’-CUGAAAGUAACUCAUAAUCUA -3’) (Qiagen). For transfection of the scFv or scFvC plasmids ...
-
bioRxiv - Microbiology 2024Quote: ... Biomass was immediately stabilized upon sampling by mixing 2 ml biomass with 6 ml PowerProtect DNA/RNA solution (1:3) (Qiagen Benelux B.V., Venlo, The Netherlands). The stabilized mixture was spun down and the remaining pellet was freeze-dried overnight and stored at −70°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... An A base was added to the 3’ ends with Klenow (3’-4’ exo-) (Qiagen). The processed ds-cDNA was then ligated to Illumina sequencing adapters with T4 DNA Ligase (Qiagen) ...
-
bioRxiv - Microbiology 2021Quote: ... NG1 (5’ACCGACCACAGGGGG-3’) and NG2 (5’-GGTTGTAAACCTCTTTCGA-3’) and HotStarTaq® Master Mix Kit (Qiagen) up to a final volume of 25 μL ...
-
bioRxiv - Cell Biology 2021Quote: ... si-FAU (5’-CCGGCGCUUUGUCAACGUUGU-3’, Qiagen), si-uS19 (5’-UCACCUACAAGCCCGUAAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-eS4X (5’-CUGGAGGUGCUAACCUAGGAA-3’, Qiagen), si-FAU (5’-CCGGCGCUUUGUCAACGUUGU-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... #4: 5’-CCGGTTTAGCTGAAGATTCAA-3’ (SI00443779, Qiagen), GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647 ...
-
bioRxiv - Neuroscience 2022Quote: ... Mice received either miRCURY LNA power inhibitor for mmu-miR-335-5p (Ant-335; sequence: 5’-CATTTTTCGTTATTGCTCTTG-3’; Qiagen, Cat No.: 339132; 0.1 nmol in 2 μL PBS), or a non-targeting scrambled control (Scr ...
-
bioRxiv - Cancer Biology 2024Quote: ... was achieved from frozen tissue biopsies upon homogenization with stainless steel beads (3–7 mm mean diameter) using TissueLyser II (QIAGEN; 20” at 30 Hz, for 2 cycles(20)) ...
-
bioRxiv - Molecular Biology 2021Quote: Ni-NTA agarose beads (Qiagen 70666-3)
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’; Qiagen), si-XPO1 (5’-UGUGGUGAAUUGCUUAUAC-3’).
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-1 (5’-UCGCUUUGGAUGGAAGUUCUA-3’, Qiagen), si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’; Qiagen), si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’ ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 3 μL Vapor-Lock (Qiagen, 981611). Plates after sorting were briefly centrifuged ...
-
bioRxiv - Cell Biology 2023Quote: ... template switching (5’- AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3’, Qiagen), and ISPCR (5’-AAGCAGTGGTATCAACGCAGAGT-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... mL64 siRNA 5’-AAGAACGCGAATGGTACCCGA-3’ (SI02652349, Qiagen), and bL36m siRNA 5’-CGGTGGTACGTCTACTGTAAA-3’ (SI04156299 ...
-
bioRxiv - Cell Biology 2023Quote: ... uL11m siRNA 5’-AGGAAGGAGGTCACACCAATA-3’ (SI04135684, Qiagen), mL65 siRNA 5’CAAGCUAUGUAUCAAGGAUtt3’ (s21375 ...
-
bioRxiv - Cell Biology 2023Quote: ... uL16m siRNA: 5’ TACGGAGTTTACAGAAGGCAA-3’ (SI00648291, Qiagen) and Negative control siRNA (SI03650318 ...
-
bioRxiv - Cell Biology 2023Quote: ... MRPL45 siRNA: 5’-CTGGAGTATGTTGTATTCGAA-3’ (SI00649005, Qiagen), bL27m siRNA 5’CAGGCAGACGCCAAGGCATTA-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647, Qiagen), uL16m siRNA ...
-
bioRxiv - Cell Biology 2023Quote: ... bL31m siRNA 5’-CCAGGCTTATGCACGACTCTA-3’ (SI00649271, Qiagen), mL64 siRNA 5’-AAGAACGCGAATGGTACCCGA-3’ (SI02652349 ...
-
bioRxiv - Genomics 2023Quote: Twenty 3 mm disc punches (UniCore, Qiagen) from each leaf sample were placed in mini-tubes with a 3 mm ball bearing ...
-
bioRxiv - Neuroscience 2024Quote: ... using a 3 mm bead (Qiagen 69997) and agitation with the Tissue Lyser II (Qiagen ...
-
bioRxiv - Cell Biology 2024Quote: ... dynamin 2 (Qiagen), CDC42 (Dharmacon) ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA was extracted from 3 knockout and 3 littermate control samples using the QIAGEN RNeasy Micro Kit (QIAGEN 74004) according to the manufacturers protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...