Labshake search
Citations for Qiagen :
351 - 400 of 1491 citations for 3 2 Methylphenoxy methyl piperidine hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... The soluble extracts were mixed for 30 min with 3 ml of Ni2+-NTA-agarose (Qiagen) that had been equilibrated with buffer A containing 10 mM imidazole ...
-
bioRxiv - Genetics 2022Quote: ... Midi, 3-4 ml of blood) and Puregene (0.3-1 ml of blood, manual extraction) (Qiagen, Cat# 1057048 ...
-
bioRxiv - Microbiology 2020Quote: RNA was extracted from 3 million transfected cells using the All Prep DNA/RNA kit (Qiagen) and quantified by Nanodrop 1000 ...
-
bioRxiv - Microbiology 2020Quote: The 3 Kb mutagenic DNA fragments were purified using a QIAquick PCR Purification Kit (Qiagen; 28106) and transformed into V ...
-
bioRxiv - Biochemistry 2020Quote: ... and pJET_Luc_FL_UTR_REV (5’-GCAATGAAAATAAATGTTTTTTATTAGGCAGAATCCAAATGC-3’) primers and was purified with the QIAquick PCR Purification Kit (Qiagen) directly after the PCR reaction ...
-
bioRxiv - Genetics 2021Quote: RNA was extracted from an aliquot of 3 × 106 cells using the RNeasy Plus Kit (Qiagen). cDNA was synthesized from extracted RNA using the iScript cDNA Synthesis Kit (BioRad) ...
-
bioRxiv - Cell Biology 2021Quote: ... Media and osteoblasts were harvested 3 days later and EVs were collected using Exoeasy kit (Qiagen). Total RNA was extracted using miRNeasy micro (Qiagen).
-
bioRxiv - Cancer Biology 2021Quote: ... RNA from 3 x 106 HMC-1.2 cells was extracted using RNeasy Plus Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-month-old zebrafish (1 fish/sample) using the RNeasy Mini Kit (Cat. No. 74104; Qiagen) per the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... 3 min in 37°C shaker) and processed with DNeasy Blood and Tissue Kit (QIAGEN #69504). Two hundred ng of genomic DNA was used as input in the DamID protocol that included an improved pool of AdR primers as described (de la Cruz Ruiz et al ...
-
bioRxiv - Microbiology 2023Quote: ... and the supernatant was added to 3 ml of Ni-nitrilotriacetic acid (NTA) superflow resin (Qiagen) and the mixture was applied onto a gravity drip column ...
-
bioRxiv - Cancer Biology 2024Quote: ... and total RNA was extracted using the RNAeasy Mini kit (Qiagen, 74104; n = 3 independent experiments). Prior to library construction ...
-
bioRxiv - Microbiology 2023Quote: ... Samples were mechanically disrupted for 2x 3 min at 30 Hz (TissueLyser II, Qiagen, Hilden, Germany). This was followed by adding 5 μl of proteinase K (20 mg/ml ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA was isolated (n = 3 or 4 mice per sample) using the RNeasy Mini Kit (QIAGEN), and aRNA was synthesized with Ambion’s MessageAmp aRNA Kit (Catalog # 1750 ...
-
bioRxiv - Cell Biology 2022Quote: ... A Locked Nucleic Acid (LNA) probe was used to detect centromere regions (5’-TTGGCTACACCATGAAAGCTT-3’; Qiagen). 20 μL of probe mix (250 nM LNA probe ...
-
bioRxiv - Microbiology 2022Quote: ... 3 mL samples were added to tubes containing 6 mL RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany) and vortexed ...
-
bioRxiv - Microbiology 2023Quote: ... whole eyes were homogenized in PBS using a TissueLyser II (Qiagen, 30 Hz for 3 minutes), and homogenates were serially diluted and streaked on LB plates for quantification of colony forming units (CFU ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The obtained 5□- and 3□-RACE products were purified using a QIAquick Gel Extraction Kit (QIAGEN), subcloned into a pTAC-2 Vector (Bio Dynamics Laboratory lnc. ...
-
bioRxiv - Plant Biology 2024Quote: ... 3-4 plants were pooled and RNA was extracted using the RNeasy plant mini kit (Qiagen). 100 ng of total RNA per sample determined using a Qubit fluorometer (Thermofisher) ...
-
bioRxiv - Microbiology 2024Quote: ... Demultiplexed raw reads were trimmed for quality and 3’ adaptors using the CLC Genomics Workbench (Qiagen). Reads were mapped to PAO1 ...
-
bioRxiv - Microbiology 2024Quote: ... whole eyes were homogenized in PBS using a TissueLyser II (Qiagen, 30 Hz for 3 minutes), and homogenates were serially diluted plated on LB agar plates for quantification of colony forming units (CFU ...
-
bioRxiv - Microbiology 2024Quote: ... and homogenized by bead-beating with 3 x 5 mm stainless steel beads (Qiagen, Hilden, Germany) in 1 ml sterile 1X PBS to produce internal fly-bacterial suspensions.
-
bioRxiv - Microbiology 2024Quote: 3-5 × 105 cells were harvested and total RNA was extracted using the RNeasy kit (Qiagen) employing on-column DNase treatment ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 independent PCR reactions were pooled and purified using the QIAquick PCR Purification Kit (Qiagen #28106).
-
bioRxiv - Genomics 2024Quote: Genomic DNA was extracted from 3 × 106 cells using QiaAmp DNA Blood Mini Kits (Qiagen 51104) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... Amplified 3’UTRs were size selected and purified using the QIAquick Gel Extraction kit (Qiagen, #28704) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA synthesis was performed using RT^2 First Strand Kit (Qiagen) and run on the RT^2 First Strand Kit (Stem cell PCR array ...
-
bioRxiv - Genomics 2021Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Microbiology 2021Quote: ... In replicates 1 and 2 a Universal extraction robot (Qiagen, Germany) and associated nucleic acid extraction (Qiagen ...
-
bioRxiv - Plant Biology 2021Quote: ... Supernatant was mixed with 2 mL of Ni-NTA agarose (Qiagen) on a rotary shaker for 1 h at 4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... and finally eluted in 2 x 30 μL EB Buffer (Qiagen) at 60°C.
-
bioRxiv - Genomics 2020Quote: ... or (ii) QIAseq SARS-CoV-2 Primer Panel (Qiagen GmbH, Germany) for amplified of viral genome sequencing or (iii ...
-
bioRxiv - Biochemistry 2021Quote: ... and then stirred with 2 ml Ni-NTA Superflow resin (Qiagen) that had been pre-equilibrated with Buffer A for 10 min on ice ...
-
bioRxiv - Systems Biology 2020Quote: ... Samples were collected into 2 ml round bottom microcentrifuge tubes (Qiagen) and weighed prior to freezing ...
-
bioRxiv - Cell Biology 2021Quote: ... Cleared lysate was incubated with 2 mL Ni-NTA agarose (Qiagen) for 1 hr and washed with 50 mL wash buffer (1X PNI ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cleared lysates were incubated with 2-4ml nickel NTA beads (Qiagen) for 20-40 minutes before washing beads with 5-10 column volumes of lysis buffer ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This mixture was diluted a further 2× into an Omniscript (Qiagen) RT reaction following the manufacturer’s instructions and incubated at 50°C for 20 min followed by heat inactivation at 95°C for 2 min ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was mixed with 2 ml Ni-NTA agarose (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Microbiology 2023Quote: EHEC cultures were mixed with 2 volumes of RNAprotect reagent (Qiagen), incubated at room temperature for 5 minutes and harvested by centrifugation ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eIF3B – C 2: GACCGACTTGAGAAACTCAAA) were synthesized by QIAGEN (Hilden, Germany). For transfection ...
-
bioRxiv - Microbiology 2024Quote: ... The columns were put on new 2 mL collection tubes (Qiagen) and centrifuged at 15000 rpm for 1 min to dry the columns ...
-
bioRxiv - Microbiology 2024Quote: ... using a 2 ml Tube Holder Set (QIAGEN; Cat. No. 11993), and DNA extractions were eluted with C6 Elution Buffer in a final volume of 80 µl ...
-
bioRxiv - Immunology 2022Quote: ... 2 μg/ml TPCK-trypsin) using a Tissue Lyser II (Qiagen) with the following program ...
-
bioRxiv - Immunology 2023Quote: ... starting from step 2 of the RNeasy micro kit (Qiagen, #74004) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... root or shoot tissues were ground in 2 mL tubes (Qiagen) containing 3 chrome steel beads of 3.2 mm diameter (BioSpec Products ...
-
bioRxiv - Microbiology 2024Quote: ... for 2 hours and purified using QIAquick PCR Purification Kit (Qiagen). Guide RNA sequence was ordered as oligos (Tm = 51°C ...
-
bioRxiv - Microbiology 2024Quote: ... cells were treated with 2× volume of RNAprotect Bacteria Reagent (QIAGEN) for 10 min at room temperature and collected as pellets by centrifugating for 10 min at 5,000×g ...
-
bioRxiv - Genomics 2024Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Genomics 2024Quote: ... 2 ml of RNAprotect® Bacteria Reagent (cat # 76506, Qiagen Inc.) was added ...
-
bioRxiv - Genomics 2020Quote: ... The primer used in the 3’ RACE assay was designed using CLC Genomic Workbench (ver. 10.1.1, Qiagen) near the highest CAGE-Seq signal in the determined TSS region ...