Labshake search
Citations for Qiagen :
9851 - 9900 of 10000+ citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... genomic extractions were performed using QIAamp UCP DNA Micro Kit (QIAGEN) by following manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... Plasmid DNA was isolated using the Plasmid Plus Maxi Kit (Qiagen).
-
bioRxiv - Immunology 2023Quote: ... M1/M2 Mφ and DCs using the miRNeasy mini-kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... The double-stranded RNA was purified using the RNeasy kit (Qiagen) and 0.2 μg in 69 nL was injected through the mesothoracic spiracle into the hemocoel cavity of A ...
-
bioRxiv - Microbiology 2023Quote: ... with the other plasmids were extracted by plasmids midi kit (QIAGEN) according to the manufacturers’ protocols ...
-
bioRxiv - Microbiology 2023Quote: RNA was purified using RNeasy Plus Mini Kit (QIAGEN, Germantown, MD) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: RNA extraction was performed using the RNeasy Mini Kit (Qiagen, 74104) and DNA was eliminated by on-column treatment with DNase I (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... After reverse transcription with the Quantitect reverse transcription kit (Qiagen, 205311), SYBR green qPCR was performed (Takyon ...
-
bioRxiv - Plant Biology 2023Quote: ... coli cells using a miniprep kit from Qiagen (Germantown, MD, USA) following the recommended protocol ...
-
bioRxiv - Plant Biology 2023Quote: Genomic DNA was extracted using a DNeasy Plant mini kit (Qiagen) from three biological replicates per genotype (leaves from a pool of three seedlings collected 15 das from three different Petri plates) ...
-
bioRxiv - Plant Biology 2023Quote: Total RNA was isolated using the RNeasy kit (Qiagen, MD, USA), followed by treatment with DNaseI (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2023Quote: ... and cleaned with RNeasy MinElute Clean up Kit (Qiagen, Hilden, Germany). RNA concentrations were determined using NanoDrop 1000 (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2023Quote: Total RNA was extracted using the RNeasy Plant Mini Kit (Qiagen) and stored at -20°C ...
-
bioRxiv - Microbiology 2023Quote: ... and chloroform extraction and purification through Qiagen columns (Qiagen RNAeasy Kit). RNA quantity and quality was estimated by Nanodrop and through gel electrophoresis before submission to the Dartmouth Genomics Core Facility ...
-
bioRxiv - Microbiology 2023Quote: ... purified from the gel using a QIAquick gel extraction kit (Qiagen), and reamplified by PCR with primers hlpA-up1 and hlpA-down2 ...
-
bioRxiv - Immunology 2023Quote: Total RNA was isolated from cells using miRNeasy Micro Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... and Diphasiastrum complanatum by using the RNeasy Plant Mini kit (Qiagen). The integrity of the RNA was determined with an Agilent 4200 Bioanalyzer system (Agilent Technologies ...
-
bioRxiv - Systems Biology 2023Quote: ... RNA was obtained according to the RNeasy mini kit (Qiagen, 74004) extraction protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Genomic DNA was extracted using the DNeasy Blood &Tissue Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA libraries were purified using the QIAquick PCR Purification Kit (QIAGEN) and sequenced using a HiSeq 1500 machine (Illumina ...
-
Borrelia PeptideAtlas: A proteome resource of common Borrelia burgdorferi isolates for Lyme researchbioRxiv - Biochemistry 2023Quote: ... Total RNA was extracted using Qiagen RNEasy Mini kits (Qiagen, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... and the now discontinued DNeasy Powersoil DNA Isolation Kit (all Qiagen). For extractions with the DNeasy Powersoil Pro kit ...
-
bioRxiv - Cancer Biology 2023Quote: RNA was extracted using the RNeasy mini kit (Qiagen, Hilden, Germany). Extracted RNA was quantified and its purity (absorbance at 260/280 nm ...
-
bioRxiv - Genetics 2023Quote: ... total RNA was extracted using the RNeasy Mini Kit (74106, Qiagen). After quantifying single-strand RNA concentration using Nanodrop ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids were extracted with the Plasmid Mini Kit (Qiagen, Hilden, Germany). All primers used in this study are listed in the Supplementary Table 2 ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by a column cleanup using the RNeasy Mini kit (Qiagen) with two additional washes (75% ethanol ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA was isolated using the Qiagen RNeasy Mini Kit (QIAGEN GmbH) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: Genomic DNA was extracted using the DNeasy Blood & Tissue Kit (Qiagen) and CTNNB1 exon 3 was amplified using GoTaqβ G2 Flexi DNA Polymerase (Promega ...
-
bioRxiv - Cancer Biology 2023Quote: ... Tagmented DNA was purified using a MinElute PCR Purification Kit (Qiagen), then minimally amplified for sequencing as previously described97 ...
-
bioRxiv - Bioengineering 2023Quote: ... Total tissue DNA was extracted using the DNeasy Tissue Kit (Qiagen). The random oligonucleotide insertions from the enriched AAV library particles were amplified by PCR using the primers 5’–GGAGCTTCTTCTTGGGCTCT–3’ and 5’– AGCGGAGAAGGGTGAAAGTT–3’ ...
-
bioRxiv - Cancer Biology 2023Quote: ... and from blood by using either DNeasy Blood & Tissue Kit (Qiagen) or Maxwell® RSC Blood DNA Kit ...
-
bioRxiv - Genomics 2023Quote: ... and purified with the RNeasy Mini Kit (QIAGEN Cat. No. 74106). Libraries were constructed with the NEBNext Ultra Directional RNA Library Prep Kit for Illumina according to manufacturer’s recommendations (NEB ...
-
bioRxiv - Genetics 2023Quote: ... genomic DNA was isolated from cells using Gentra Puregene Kit (Qiagen) and CRISPR-induced deletions were confirmed via PCR using primers adjacent to each end of the deletion ...
-
bioRxiv - Genomics 2023Quote: ... reactions were pooled and purified using QIaquick PCR purification kit (QIAGEN). Then ...
-
bioRxiv - Microbiology 2023Quote: ... oral and vaginal specimens using the QIAamp DNA Mini Kit (QIAGEN) with some modification ...
-
bioRxiv - Developmental Biology 2023Quote: Total RNA was extracted from samples using RNeasy mini kit (Qiagen) and the resulting RNAs were reverse transcribed using SuperScript III Reverse Transcriptase (Life Technologies) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Total RNA was extracted using the miRNeasy isolation kit (Qiagen 7004). Total RNA was retro-transcribed using SuperScriptTM VILOTM cDNA Synthesis Kit (ThermoFisher ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 1 colonies using a DNeasy Plant Mini Kit (QIAGEN, Hilden, Germany). We used DNeasy Blood & Tissue Kits (QIAGEN ...
-
bioRxiv - Genetics 2023Quote: ... RNA isolation was performed using RNeasy Micro Kit (Qiagen, cat# 7004), and reverse transcription was done using the iScript cDNA Synthesis Kit ...
-
bioRxiv - Genetics 2023Quote: ... RNA was extracted using the RNeasy Plus Micro Kits (Qiagen #74034) and used to prepare RNA libraries utilizing the TruSeq Stranded mRNA Kit (Illumina #20020595 ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was extracted from cells using RNeasy Kits (74004, QIAGEN) following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... extraction was performed using the MagAttract® HMW DNA Kit (Qiagen), following the manufacturer’s protocol with the whole specimen immersed in extraction buffer and proteinase K overnight ...
-
bioRxiv - Physiology 2023Quote: ... and RNA was isolated by using RNeasy Mini Kit (74104; Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... Extraction was performed using RNeasy® mini kit (Qiagen, Hilden, Germany) according to the protocol provided by the manufacturer.
-
bioRxiv - Genetics 2023Quote: ... all samples were cleaned using the Qiagen MinElute Kit (Qiagen, #28006) following manufacturer instructions and eluted in 10 µL EB buffer ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were prepared using the Qiagen HMR kit (Qiagen, Hilden, Germany). Paired-end sequencing was performed using the NextSeq 500 platform (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... the sequence reactions were purified DyeEx Kits (Qiagen GmbH, Hilden, Germany) and were analyzed using the 3500 XL DNA Analyzer (Applied Biosystems ...
-
bioRxiv - Immunology 2023Quote: ... PCR products were purified using a PCR purification kit (Qiagen, 28006) and then cloned into the AbVec expression plasmids to produce recombinant human IgG1 mAbs (a gift from Patrick C ...
-
bioRxiv - Cancer Biology 2023Quote: ... and plasmid DNA was extracted using an EndoFree Maxi Kit (QIAGEN).
-
bioRxiv - Neuroscience 2023Quote: ... First-strand cDNA was synthesized using QuantiTect Reverse Transcription Kit (QIAGEN). Real-time PCR was performed using SYBR® Premix Ex Taq™ II (Takara Bio ...