Labshake search
Citations for Qiagen :
9701 - 9750 of 10000+ citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: RNA extraction was performed using the miRNeasy Mini kit (Qiagen #1038703), following the kit’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... gel extraction and purification using the QIAquick Gel Extraction Kit (Qiagen) and Sanger sequencing ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA was purified using AllPrep DNA/RNA FFPE Kit (Qiagen, #80234) and concentrated in a vacuum concentrator if required and stored at -20°C until further processing ...
-
bioRxiv - Genomics 2023Quote: ... RNA was isolated manually using the RNeasy PLUS mini kit (Qiagen). The cell pellets were assigned to processing batches (12 batches of 48 samples and one of 24 samples ...
-
bioRxiv - Genetics 2023Quote: ... DNA was extracted using either the DNeasy Plant Mini Kit (Qiagen) or a modified CTAB protocol ...
-
bioRxiv - Plant Biology 2023Quote: ... Plasmid DNA was isolated using the QIAprep Spin Miniprep Kit (Qiagen) and sequence verified by Elim Biopharm.
-
bioRxiv - Microbiology 2023Quote: RNA was extracted from cells using the RNAeasy Plus Kit (QIAGEN), while viral RNA present in cell culture SN was isolated using the QIAamp Viral RNA Mini Kit (QIAGEN) ...
-
bioRxiv - Cell Biology 2023Quote: Total RNA was extracted from cells using an RNEasy kit (Qiagen), and cDNA was synthesized using a SensiFast cDNA kit (Bioline ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA was purified using a RNeasy Plus Mini Kit (Qiagen, 74136) and analyzed on a Nanodrop 2000c (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: mRNA was extracted and purified using the RNeasy Mini kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2023Quote: ... First-strand cDNA synthesis was performed with the Omniscript kit (Qiagen). Quantitative real-time PCR was performed with the SsoFast EvaGreen Supermix Kit (BioRad ...
-
bioRxiv - Bioengineering 2023Quote: ... We extracted total RNA using miRNeasy Mini Kit (Qiagen, Cat# 217004) from 20 sexed pupae ...
-
bioRxiv - Microbiology 2023Quote: ... RNA purification was performed with the RNeasy Mini kit (QIAGEN, #74106) according to manufacturer instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... genomic DNA was isolated using QIAamp DNA maxi kit components (Qiagen). Unsorted cells were divided such that each column purified genomic DNA from no more than 1 x 108 cells ...
-
bioRxiv - Physiology 2024Quote: Total RNA was extracted using RNeasy Mini Kit (Qiagen, Hilden, Germany) with on-column DNase digestion (Qiagen ...
-
bioRxiv - Plant Biology 2024Quote: ... Eluted DNA was purified using a Minelute PCR purification kit (Qiagen) and sent for sequencing ...
-
bioRxiv - Plant Biology 2024Quote: Total RNA was isolated with a RNeasy plant mini kit (Qiagen). To eliminate contaminating genomic DNA ...
-
bioRxiv - Plant Biology 2024Quote: ... using Qiagen DNeasy® Plant Mini Kit (QIAGEN Ltd., Manchester, UK) or CTAB protocols (Kelly et al. ...
-
bioRxiv - Plant Biology 2024Quote: The total RNA was isolated using the RNeasy Micro Kit (Qiagen). Briefly ...
-
bioRxiv - Plant Biology 2024Quote: ... Total RNA was extracted with the Plant RNeasy mini kit (Qiagen) according to manufacturer instructions with on-column treatment of RNase-free DNase I ...
-
bioRxiv - Plant Biology 2024Quote: ... Genomic DNA was extracted using a DNA Plant Mini Kit (Qiagen).
-
bioRxiv - Immunology 2023Quote: ... Plasmid was extracted by using the commercial kit from Qiagen (Germany), following manufacturers protocols.
-
bioRxiv - Bioengineering 2024Quote: ... Total RNA was extracted using the RNeasy mini kit (74104, Qiagen) with off-column TURBOTM DNase treatment (AM2239 ...
-
bioRxiv - Physiology 2024Quote: ... Pituitary RNA was extracted using the RNeasy Plus Mini Kit (Qiagen) with Qiagen QIA Shredder™ 250 ...
-
bioRxiv - Plant Biology 2024Quote: ... The plasmid DNA was extracted using QIAprep Spin Miniprep Kit (Qiagen) and the plasmid DNA was verified for the cloned PCR fragment with Sanger sequencing using the pJET_F and pJET_R primer set.
-
bioRxiv - Immunology 2024Quote: ... QIAamp Fast DNA Stool Mini Kit (Cat # 51604, Qiagen, Hilden Germany) was utilized to extract DNA from the homogenized content ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... We purified the resulting dsRNA using a RNeasy purification kit (Qiagen) and eluted it in Spradling injection buffer (Rubin and Spradling 1982 ...
-
bioRxiv - Immunology 2024Quote: ... and total RNA was extracted using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Genomic DNA was extracted using the QIAamp DNA Mini Kit (Qiagen) according to manufacturers’ instructions and concentration and quality were confirmed by NanoDrop spectroscopy ...
-
bioRxiv - Microbiology 2024Quote: ... The resulted PCR amplicons were purified (QIAquick PCR Purification Kit, Qiagen) and ligated into pBAD/Thio-TOPO plasmid vector (Thermo Fisher Scientific) ...
-
bioRxiv - Genetics 2023Quote: ... total RNA was extracted using the RNeasy Mini Kit (74106, Qiagen). After quantifying single-strand RNA concentration using Nanodrop ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids were extracted with the Plasmid Mini Kit (Qiagen, Hilden, Germany). All primers used in this study are listed in the Supplementary Table 2 ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmid DNA was extracted using QIAprep Spin Miniprep Kit (QIAGEN), as per manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... The RNAs were extracted using QIAGEN RNeasy Midi Kit (QIAGEN 75144) and mRNAs were selected with Invitrogen Dynabeads mRNA Purification Kit (Invitrogen 61006 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Reactions were cleaned up using the MinElute PCR purification kit (QIAGEN) and DNA was eluted in 10 µ elution buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... Total RNA was isolated using RNeasy Plus Universal Kit (QIAGEN, USA) following the manufacturer’s instructions including DNase I treatment using RNase-Free DNase Set and on-column protocol (QIAGEN ...
-
bioRxiv - Evolutionary Biology 2023Quote: We extracted DNA using QIAGEN DNeasy Plant Mini Kits (QIAGEN Inc.). Dual-indexed GBS (genotyping-by-sequencing ...
-
bioRxiv - Immunology 2022Quote: ... each DNA sample was purified using MinElute PCR Kit (Qiagen, 28004) and eluted in 30 μL of Buffer EB ...
-
bioRxiv - Microbiology 2022Quote: ... RNA extraction was carried out using a RNeasy mini kit (Qiagen) and genomic DNA depleted using a TURBO DNA-free kit (Ambion) ...
-
bioRxiv - Microbiology 2022Quote: ... and thereafter purified with QIAquick PCR Purification Kit (Qiagen, Hilden, Germany). All steps were carried out according to the protocols supplied by the manufacturers.
-
bioRxiv - Microbiology 2022Quote: ... at −80 °C using the RNeasy plus Mini Kit (Qiagen, 74134) according to the manufacturers protocol ...
-
bioRxiv - Microbiology 2022Quote: ... we followed the protocol of the RNeasy Protect Bacteria Kit (Qiagen) combined with on-column DNase digestion using the RNase-Free DNase Set (Qiagen) ...
-
bioRxiv - Microbiology 2022Quote: ... Reverse transcription was performed using the QuantiTect reverse transcription kit (Qiagen) using virus-specific reverse primers for SINV (GTTGAAGAATCCGCATTGCATGG) ...
-
bioRxiv - Microbiology 2022Quote: ... total RNA was reverse transcribed using the Omniscript RT kit (Qiagen), and the resulting DNA was amplified with the HotStarTaq DNA Polymerase (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmids were isolated from the strains using the DNeasy kit (Qiagen), re-transformed into E ...
-
Rac1, Rac3 GTPases and TPC2 are required for axonal outgrowth and migration of cortical interneuronsbioRxiv - Neuroscience 2022Quote: ... was extracted and purified on columns (Qiagen RNeasy Plus Micro kit) and consequently was subjected to mRNA isolation ...
-
bioRxiv - Neuroscience 2022Quote: ... and total RNA was isolated using RNeasy MinElute Cleanup Kit (Qiagen). mRNA was enriched by poly-A capturing and RNA-seq libraries were generated using KAPA mRNA HyperPrep Kit (KAPA Biosystems).Libraries were sequenced using the Illumina HiSeq 1500 platform.
-
bioRxiv - Immunology 2022Quote: RNA was extracted from podocytes using the RNeasyPlus Mini Kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... and total cellular RNA was purified using the RNeasy kit (Qiagen). cDNA was synthesized from the purified RNA by both random and oligo(dT ...
-
bioRxiv - Cancer Biology 2022Quote: ... ShRNA plasmids were purified with QIAprep Spin Miniprep Kit (#27106, Qiagen) after overnight incubation with E-coli bacteria ...