Labshake search
Citations for Qiagen :
901 - 950 of 3161 citations for 1 1' 3' 1'' Terphenyl 4 4'' dimethanamine 5' 4 aminomethyl phenyl 9CI since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2023Quote: ... 1 colonies using a DNeasy Plant Mini Kit (QIAGEN, Hilden, Germany). We used DNeasy Blood & Tissue Kits (QIAGEN ...
-
bioRxiv - Microbiology 2023Quote: ... plus 1% ꞵ-mercaptoethanol and homogenized using a QIAshredder column (QIAGEN). RNA was extracted using the RNeasy Mini kit (QIAGEN) ...
-
bioRxiv - Physiology 2023Quote: ... The tissue lysates were treated with 1% DNase (Qiagen, Hilden, Germany) and diluted to a protein concentration of 10μg/ml ...
-
bioRxiv - Microbiology 2023Quote: ... then transferred to 1 ml RNAprotect Tissue Reagent (Qiagen, Hilden, Germany) for colonic transcript analyses ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 mL of washed Ni-NTA beads (Qiagen catalog no. 30210) were added for each 50 mg of total ubiquitin in the reaction ...
-
bioRxiv - Bioengineering 2024Quote: ... 1 mL of 50% Ni-NTA agarose (Qiagen, Toronto, Ontario, Canada) was equilibrated using 10 bed volumes of wash buffer (same formulation as lysis buffer) ...
-
bioRxiv - Molecular Biology 2024Quote: ... the remaining wash buffer was removed and 1 ml QIAzol (Qiagen) was added to the beads and incubated at RT for 10 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... and the mixture was incubated with 1 mL Ni-NTA (Qiagen) beads at 4 ºC for 1 h to remove TEV protease ...
-
bioRxiv - Genomics 2023Quote: ... 1% SDS and 0.6 mg/mL Proteinase K (Qiagen, cat#19131) and 0.4 mg/mL RNaseA (Thermo Fisher ...
-
bioRxiv - Plant Biology 2022Quote: ... the PCR products were ligated into expression vector pQE-1 (Qiagen) with T4 ligase (New England BioLabs) ...
-
bioRxiv - Plant Biology 2022Quote: ... samples were shaken for 1 min in a TissueLyser II (Qiagen) and then centrifuged at 4ºC for 5 min at maximum speed in a tabletop microfuge ...
-
bioRxiv - Neuroscience 2023Quote: ... 1% NP-40) and immediately placed in “RTL plus” buffer (Qiagen). The mRNA was purified using the RNase micro KIT (Qiagen) ...
-
bioRxiv - Neuroscience 2023Quote: ... 100 µl whole blood was homogenised in 1 ml QIAzol (Qiagen) using a TissueLyser II (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: RNA was extracted from Caki-1 cells using the RNeasy (Qiagen) kit according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... at room temperature for 1 hour and Proteinase K (Qiagen 158918) at 55°C for 2 hours followed by a reverse cross-link at 65°C overnight ...
-
bioRxiv - Microbiology 2024Quote: ... the supernatant was loaded onto a 1 ml StrepTactin column (Qiagen) at a flow rate of 0.7 ml/min in the ÄKTA prime-plus liquid chromatography system (GE Healthcare) ...
-
bioRxiv - Microbiology 2024Quote: ... containing 1% β-mercaptoethanol and 0.5% (v/v) Reagent DX (Qiagen). Tissues were then disrupted using the TissueRuptor (Qiagen ...
-
bioRxiv - Molecular Biology 2024Quote: ... Reactions were then diluted 1:10 with nuclease-free water (Qiagen) and stored at −20°C until needed.
-
bioRxiv - Molecular Biology 2024Quote: ... The supernatant was mixed with 1 ml Ni-NTA beads (Qiagen), and washed with 10 ml PBS before use ...
-
bioRxiv - Bioengineering 2024Quote: ... and 350 μL of lysis buffer (RLT + 1% β- mercaptoethanol, Qiagen) was perfused through each channel ...
-
bioRxiv - Immunology 2024Quote: ... 1- 30k cells per population were lysed in RLT buffer (Qiagen) with 10 uL/mL 2-ME (Merck ...
-
bioRxiv - Bioengineering 2024Quote: ... supernatant was applied to 1 mL of Ni-NTA resin (Qiagen) for gravity chromatography ...
-
bioRxiv - Immunology 2021Quote: ... and probe (375 nM, 5’-6FAM-ACACTAGCC/ZEN/ATCCTTACTGCGCTTCG-IABkFQ-3’) with 12.5μL of 2X QuantiFast Probe Mix (QIAGEN), 0.25μL of 2X QuantiFast RT Mix (QIAGEN) ...
-
bioRxiv - Microbiology 2021Quote: ... Protein lysates were separated on NuPage 5-12% Bis-Tris or 3-8% Tris-Acetate gels (Novex, Qiagen) using MES running buffer (Novex ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... For experiments with HURP knockdown the custom siRNA with 5’ to 3’ sequence used was AGUUACACCUGGACUCCUUTT (Qiagen, 1027423).
-
bioRxiv - Neuroscience 2023Quote: ... LNA-CTG and the control scrambled LNA-modified sequence (LNA-SCB) 5′-GTGTAACACGTCTATACGCCCA-3′ were obtained from Qiagen as previously described in Rue et al 34
-
bioRxiv - Cancer Biology 2024Quote: ... total RNA was extracted from 3 – 5 x 106 cells using Rneasy kit with Dnase I treatment (QIAGEN), following manufacture instructions ...
-
bioRxiv - Cell Biology 2020Quote: RNA was extracted from 1 million cells with RNeasy mini Kit (Qiagen) following the manufacturer’s instructions and with DNase treatment on column ...
-
bioRxiv - Developmental Biology 2021Quote: RNA was isolated from 1×103-2.5×106 cells using QIAzol (Qiagen). Total RNA was extracted using miRNeasy Mini kit (Qiagen) ...
-
bioRxiv - Microbiology 2020Quote: ... and the pellet was immediately resuspended in 1 mL RNA-Protect (Qiagen). RNA-stabilized cell pellets were stored at −80 °C.
-
bioRxiv - Microbiology 2020Quote: ... 1 mL was centrifuged and washed twice with nuclease-free water (Qiagen). The cell pellet was resuspended in 500 µL of nuclease-free water ...
-
bioRxiv - Biochemistry 2020Quote: ... PARP-1 was purified by sequential application to Ni-NTA agarose (Qiagen), HiTrap Heparin HP column (GE Healthcare) ...
-
bioRxiv - Cell Biology 2020Quote: ... was carried out after treatment with 50 μg ml−1 RNase (Qiagen) for 20 min at 37°C ...
-
bioRxiv - Neuroscience 2020Quote: ... with 1 µL cDNA using the following oligonucleotides (QuantiTect Primer Assays, Qiagen): Gli1 (Gli1 ...
-
bioRxiv - Neuroscience 2020Quote: ... and 1% Triton X-100 and homogenized in a TissueLyser II (Qiagen), centrifuged at 20,000 rcf at 4°C for 10 minutes after which the supernatant was collected for multiplexed immunoassay analyses.
-
bioRxiv - Plant Biology 2021Quote: ... Genomic DNA (1 μg) isolated using a DNeasy plant mini kit (Qiagen) was used for library construction ...
-
bioRxiv - Plant Biology 2021Quote: ... nks1-1 and nks1-2 using RNeasy Plant mini kit (74904, QIAGEN). cDNA was synthesized from 1 μg total RNA using iScript cDNA synthesis kit (1706691 ...
-
bioRxiv - Microbiology 2020Quote: ... and incubated with primary antibody (Penta·His Antibody, QIAGEN®, 1:2000 dilution) in 1% bovine serum albumin in PBST for 2h at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... The followed antibodies and dilutions were used: Strep 1:1000 (Qiagen, 34850), PAF1 1:1000 (Bethyl Labs #A300-173A) ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA (1 μg) was was extracted using miRNeasy Mini Kit (Qiagen) and applied to either miR-based or mRNA based reverse transcription ...
-
bioRxiv - Biochemistry 2020Quote: ... we took 1 µg of plasmid (typically from a midi-prep (Qiagen)) and digested in a 20 µL reaction with 20 units of BamHI-HF (NEB ...
-
bioRxiv - Biophysics 2020Quote: ... the surface was incubated with 1 nM biotinylated penta-His antibody (Qiagen) in buffer A for 10 min ...
-
bioRxiv - Genomics 2022Quote: ... total RNA was extracted from 1 million cells using RNeasy columns (QIAGEN). Ribosomal RNA (rRNA ...
-
bioRxiv - Microbiology 2020Quote: ... and IFN-stimulated DF-1 and CEF using the RNeasy kit (Qiagen) according to the manufacturer’s instructions as previously described48 ...
-
bioRxiv - Immunology 2021Quote: ... the supernatant was loaded onto a 1 ml Strep-Tactin column (Qiagen) at a flow rate of 0.7 ml/min in the ÄKTA prime-plus liquid chromatography system (GE Healthcare) ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 µg RNA was reverse transcribed using QuantiTect Reverse Transcription Kit (Qiagen) according to the manufacture’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... The clarified lysate was incubated with 1 ml Ni-NTA resin (Qiagen) for 1 h ...
-
bioRxiv - Biochemistry 2022Quote: Aliquots (1 ml) of culture were added to RNAProtect Bacteria Reagent (Qiagen) (2 ml) ...
-
bioRxiv - Genomics 2020Quote: ... and 1 μl of diluted (0.08x) QIAseq FastSelect 5S/16S/23S (Qiagen) were added into 6 μl COVID-19 specimen RNA along with 3 μl NA denaturation buffer ...