Labshake search
Citations for Qiagen :
1151 - 1200 of 3161 citations for 1 1' 3' 1'' Terphenyl 4 4'' dimethanamine 5' 4 aminomethyl phenyl 9CI since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... and the amplified DNA bands from the 5’ and 3’ ends were individually excised and purified with QIAquick® Gel Extraction Kit (QIAGEN). Purified PCR products were cloned into pJET1.2/blunt plasmid (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2022Quote: ... Cells were maintained at 37°C in 5% CO2 for 3 days before collecting genomic DNA using DNeasy Blood & Tissue Kits (Qiagen, 69504) and sequencing.
-
bioRxiv - Neuroscience 2022Quote: ... or a non-targeting scrambled control (Scr; sequence: 5’-TAACACGTCTATACGCCCA-3; Qiagen, Cat No.: 339137; 0.1 nmol in 2 μL PBS), using a 2 μL Hamilton syringe at a rate of 1 μL/min ...
-
bioRxiv - Cell Biology 2024Quote: Hand SFs were transfected with 50 nM antisense LNA targeting HOXD10 (Qiagen, Sequence: 5′-TGT CTG CGC TAG GTG G-3′), HOXD11 (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... Blood was obtained for lymphocyte preparation 3-5 days after the fifth immunization and RNA was prepared from lymphocytes using the RNeasy kit (Qiagen, Valencia, CA). A VHH-display phage library was prepared essentially as described previously [70] following each of the rounds of alpaca immunization ...
-
bioRxiv - Microbiology 2020Quote: ... Total DNA was extracted from 1 ml liquid samples using DNeasy Blood & Tissue kit (Qiagen). The variable ends of subtype II-C and type VI-B loci (C1 and C2 ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Genomics 2020Quote: Total RNA was extracted from 1–2 million cells using the AllPrep Mini kit (QIAGEN) according to the manufacturer’s instructions and 1 μg of total RNA was used to prepare each RNA-seq library ...
-
bioRxiv - Microbiology 2021Quote: ... The qPCR reaction mixture (10 μL) comprised 1× Rotor-Gene SYBR green PCR mix (Qiagen), 500 nM of each primer ...
-
bioRxiv - Genomics 2020Quote: RNA was purified from approximately 1 × 107 CHM13 cells using an RNeasy kit (Qiagen; 74104) and prepared into Iso-Seq libraries following a standard protocol68 ...
-
bioRxiv - Genomics 2020Quote: ... S2 cells were transfected with 1 ug plasmid DNA using the Effectene reagent kit (Qiagen). The plasmid DNA which contains cDNA of FLAG-tagged ECDs are under the metallothionein promoter control ...
-
bioRxiv - Molecular Biology 2021Quote: ... Unbound Biotin-HPDP was removed by chloroform/isoamylalcohol (24:1) extraction in MaXtract tubes (Qiagen). RNA was precipitated with 10th volume of 5M NaCl and 1 volume of isopropanol ...
-
bioRxiv - Molecular Biology 2021Quote: ... The backbone was extracted from a 1% agarose gel using QIAquick Gel Extraction Kit (Qiagen) and the minigene insert was cleaned up using QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Genomics 2020Quote: ... The supernatant of cell lysate was incubated with 1 mL Ni-NTA agarose beads (QIAGEN) at 4 °C for 1 h ...
-
bioRxiv - Bioengineering 2020Quote: Genomic DNA was isolated from 1×106 tumor cells using DNeasy Blood & Tissue Kit (Qiagen). BCMA and CS1 loci amplicons ...
-
bioRxiv - Neuroscience 2020Quote: ... then converted to cDNA using 1 µg RNA and a QuantiTect Reverse Transcription kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... MCD360-1 and the F1 progenies using the DNeasy Plant Mini Kit (Qiagen, Valencia, CA). Equal amounts of DNA were pooled from 30 responsive as well as 30 non-responsive progenies for the INF1 recognition phenotype and 29 responsive and 30 non-responsive individuals for the SCR74 response phenotype ...
-
bioRxiv - Biochemistry 2021Quote: ... and the membrane suspension was mixed with 1 ml of Ni-NTA Superflow resin (Qiagen) per 1mg of GFP–His8 and incubated for 3 hours at 4 °C ...
-
bioRxiv - Bioengineering 2021Quote: RNA was extracted from ∼1 M cells using the QIAGEN RNeasy Mini Kit (QIAGEN 74104). A total of 36 samples were prepared ...
-
bioRxiv - Neuroscience 2020Quote: ... with all primers listed in Supplementary Table 1 and then purified (QIAGEN, PCR purification kit). Before nick translation ...
-
bioRxiv - Systems Biology 2021Quote: ... 1 μg total RNA was reverse transcribed using the miScript II Reverse Transcription kit (Qiagen) according to the manufacturer’s instructions (Jay and Ciaudo ...
-
bioRxiv - Microbiology 2020Quote: ... Cell debris were eliminated by centrifugation and 1 mL of Ni-NTA superflow beads (Qiagen) was added to bind his-tagged proteins ...
-
bioRxiv - Physiology 2021Quote: ... 20 μL reactions consisted of 1×QuantiFAST reaction mix containing ROX reference dye (Qiagen, Germany), 0.66 µM of forward and reverse primers ...
-
bioRxiv - Cancer Biology 2020Quote: ... Reverse cross-linking was performed by the addition of 0.2 mg ml-1 RNaseA (Qiagen) and 0.2 mg ml-1 Proteinase K (Promega) ...
-
bioRxiv - Cell Biology 2021Quote: ... we used the sample at a 1:1000 dilution in RNAse-free water (Qiagen, 129112) (2017) ...
-
bioRxiv - Molecular Biology 2022Quote: The supernatant was mixed with 1 ml resin volume of Ni-NTA beads (Qiagen, 30210) which was pre-equilibrated with Lysis buffer supplemented with 40 mM imidazole and 0.1 mM ATP ...
-
bioRxiv - Plant Biology 2022Quote: ... The lower part of the root (1 cm) was collected directly in RLT buffer (QIAGEN) and frozen in liquid nitrogen ...
-
bioRxiv - Biochemistry 2022Quote: ... a 1:2000 dilution of a mouse anti-Penta-His Alexa Fluor 647 conjugate (Qiagen) was used.
-
bioRxiv - Cancer Biology 2022Quote: ... cDNA was prepared from 0.5-1 μg RNA using a Quantitect Reverse Transcription Kit (Qiagen) and diluted to 2.5 ng/mL in DEPC-treated water ...
-
bioRxiv - Cancer Biology 2022Quote: Cells from knockdown control or shWDR5-1 group were harvested with QIAzol Lysis Reagent (Qiagen) and homogenized using QIAshredder tubes (Qiagen) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... the supernatant was purified by 1 mL Ni2+ IMAC with Ni-NTA Superflow resins (Qiagen). Resins with bound cell lysate were washed with 10 mL (bed volume 1 mL ...
-
bioRxiv - Genomics 2020Quote: Total RNA was extracted from approximately 1 million cells using AllPrep DNA/RNA Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Genomic DNA (1 μg) was treated with bisulfite using an Epitect Bisulfite kit (Qiagen, Germany), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... homogenized in 1 ml of PBS with a steel ball by a Tissue Lyser (Qiagen) at 25 Hz for 1 min ...
-
bioRxiv - Genomics 2020Quote: Total RNA was isolated from 1×107 cells using the RNeasy Mini Kit (QIAGEN, Germany) following the protocol for enzymatic digestion of cell wall followed by lysis of spheroplasts ...
-
bioRxiv - Molecular Biology 2020Quote: ... the mixture was left to incubate in batch with 1 mL Ni-NTA resin (QIAGEN) overnight at 4°C ...
-
bioRxiv - Physiology 2021Quote: ... Reverse transcription of total RNA (1 μg) was done with QuantiTect Reverse Transcription kit (Qiagen), and cDNA quantified using LC Fast start DNA Master SYBR Green I Mix (Roche ...
-
bioRxiv - Developmental Biology 2021Quote: ... The cDNA fragment encoding residues 1-386 was cloned into the pQE-30 vector (QIAGEN). The 6×His-C2CD6 (aa 1-386 ...
-
bioRxiv - Genetics 2021Quote: ... by mixing 1 μl of RT product with 10 μl of SYBR qPCR Mastermix (Qiagen) containing the appropriate primers (345 nM of forward primer and 345 nM of reverse primer) ...
-
bioRxiv - Genomics 2020Quote: ... Beads were dried at room temperature for 1 minute and 50uL of EB buffer (Qiagen) was added slowly on top of the beads ...
-
bioRxiv - Microbiology 2021Quote: ... 20 μL reactions consisted of 1×QuantiFAST reaction mix containing ROX reference dye (Qiagen, Germany), 0.66 µM of forward and reverse primers ...
-
bioRxiv - Immunology 2020Quote: ... Samples (0.5–1×106 cells) were resuspended in 50μl of 100μg/ml RNase A (Qiagen). PI (Life Technologies ...
-
bioRxiv - Immunology 2020Quote: ... 0.125 μl 20 μM SmarterR reverse primer (30) and 1 μl PCR-grade H2O (Qiagen). The amplification was performed in a thermal cycler (lid temperature 98°C ...
-
bioRxiv - Microbiology 2021Quote: ... and 1% penicillin–streptomycin) at 300 Hz for 2 min using a Tissuelyser II (Qiagen) and centrifuged to clarify the supernatant ...
-
bioRxiv - Molecular Biology 2022Quote: ... for 1 hour and purified by agarose gel extraction (MinElute Gel Extraction Kit, Qiagen #28606). Gibson cloning was done with NEBuilder HiFi DNA Assembly Master Mix (NEB #E2621L ...
-
bioRxiv - Cancer Biology 2022Quote: Total RNA (1 μg) was first reverse-transcribed using the QuantiTect Reverse Transcription kit (Qiagen). 20 ng of total cDNA were then subjected to qRT-PCR using TaqMan Gene Expression Master Mix and pre-designed TaqMan probes (all from Applied Biosystems ...
-
bioRxiv - Cell Biology 2022Quote: ... Products were extracted from a 1% agarose gel using the QIAquick Gel Extraction Kit (Qiagen). Libraries were pooled and paired-end 150 base pair sequencing reads obtained by sequencing on a HiSeq4000 platform (Novogene) ...
-
bioRxiv - Cell Biology 2022Quote: ... Products were extracted from a 1% agarose gel using the QIAquick Gel Extraction Kit (Qiagen). TruSeq sequencing adapters were added to mutant fragments by PCR using HCM1 specific primers fused to the TruSeq universal adapter or unique TruSeq indexed adapters ...
-
bioRxiv - Immunology 2022Quote: ... after which the cells were stained with anti-Penta-His-AF647 (1 µg/mL; Qiagen) for 30 minutes at 4°C ...
-
bioRxiv - Genetics 2022Quote: ... loaded on a 1% agarose gel and purified using the QIAquick Gel Extraction Kit (Qiagen).