Labshake search
Citations for Qiagen :
9251 - 9300 of 10000+ citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... Amplified libraries were purified using the QIAquick PCR Purification Kit (Qiagen) and the quality and quantity of each library assessed using the Agilent DNA 1000 chip (Agilent Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... Genomic DNA was extracted with the DNeasy Blood & Tissue Kit (QIAGEN) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA was purified from HUVECs by using RNeasy Mini kit (QIAGEN). cDNA was synthesized using the SuperScript III First-Strand Synthesis System (Invitrogen ...
-
bioRxiv - Pathology 2023Quote: ... RNA was extracted using RNeasy Fibrous Tissue Mini kits (#74704, Qiagen). mRNA samples were shipped to Novogene for bulk mRNA sequencing ...
-
bioRxiv - Neuroscience 2023Quote: Extracted mRNA samples were reverse transcribed (Qiagen Omniscript RT kit, Qiagen) and stored at −20°C ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was extracted using QIASymphony DSP Virus Pathogen Midi kit (Qiagen) according to manufacturer’s instructions.
-
bioRxiv - Immunology 2023Quote: ... and RNA was isolated using the Qiagen RNeasy mini kit (Qiagen).
-
bioRxiv - Immunology 2023Quote: ... followed by viral RNA extraction using RNeasy Kit (Qiagen, Cat.# 74004) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: Total RNA was isolated from cells using miRNeasy Micro Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... DNA was extracted using a DNeasy extraction kit (Qiagen, Hilden, Germany). DNA quantity was assessed using a Qubit (ThermoFisher ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA synthesis was performed with the RT2 first strand kit (Qiagen) using 0.5µg RNA ...
-
bioRxiv - Microbiology 2023Quote: ... and purified by gel extraction (MinElute gel extraction kit, Qiagen, Germany). The purified insert was ligated into the cut pQE60 using T4 DNA ligase (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA was extracted using the RNeasy Plus Mini Kit (Qiagen, 74136). TruSeq® Stranded mRNA Library Prep (Illumina ...
-
bioRxiv - Synthetic Biology 2023Quote: ... All PCR products were purified using MinElute PCR Purification Kit (Qiagen) to 30 μL final volume and quantified using a NanoDrop™ One/OneC Microvolume UV-Vis Spectrophotometer (Thermo Scientific) ...
-
bioRxiv - Plant Biology 2023Quote: Genomic DNA was extracted using the DNeasy Plant Mini Kit (QIAGEN). One microgram of genomic DNA was sheared using the M220 Focused-Ultrasonicator (Covaris ...
-
bioRxiv - Plant Biology 2023Quote: ... RNA was extracted with the RNeasy® plant mini kit (QIAGEN) and ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted using QIAamp PowerFecal Pro DNA extraction kits (Qiagen) according to the manufacturer instructions with the exception that DNA was eluted in 60 μL of EB buffer (Qiagen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... while total RNA was extracted using an RNeasy Mini Kit (Qiagen), both from intact Neuro-2a cells ...
-
bioRxiv - Molecular Biology 2023Quote: ... The desire band was eluted using QIAquick Gel Extraction Kit (QIAGEN) and sent the purified DNA for sequencing (sanger sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was purified using a Qiagen PCR cleanup kit (Qiagen 28104) and subsequently subject to RT-qPCR as described above ...
-
bioRxiv - Microbiology 2023Quote: ... we extracted total DNA with the DNeasy Blood &Tissue Kit (QIAGEN) from 1.5 mL cultures ...
-
bioRxiv - Bioengineering 2023Quote: ... PCR amplicons were then purified using QIAquick PCR Purification kit (Qiagen). Purified PCR amplicons were subjected to Sanger sequencing (Eurofins Genomics) ...
-
bioRxiv - Genetics 2023Quote: ... The resulting products were purified using QIAquick PCR Purification Kit (Qiagen), after which all samples were pooled at equimolar amounts (quantified by QuBit [Invitrogen] ...
-
VapC12 ribonuclease toxin modulates host immune response during Mycobacterium tuberculosis infectionbioRxiv - Microbiology 2023Quote: Total RNAs from lungs were isolated using RNeasy Micro kit (Qiagen), and the cDNAs were synthesized by reverse transcriptase (RT ...
-
bioRxiv - Microbiology 2023Quote: ... Samples were extracted using QIAGEN DNeasy PowerSoil kits (QIAGEN, Hilden, Germany) following the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... The eluted nucleic acid was purified using the DNeasy Kit (Qiagen) and analyzed by qPCR with strong-stop primers (primers PR and PU5 ...
-
bioRxiv - Genomics 2023Quote: ... Genomic DNA was extracted using the DNeasy UltraClean Microbial Kit (Qiagen) according to the manufacturer’s instructions and was sequenced on an Illumina HiSeq2500 platform at the Wellcome Sanger Institute.
-
bioRxiv - Immunology 2023Quote: Total RNA was extracted using an RNeasy Plus Mini Kit (QIAGEN) and reverse transcribed using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems ...
-
bioRxiv - Immunology 2023Quote: ... RNA was extracted and purified using a RNeasy mini kit (Qiagen), after which cDNA was generated using an iScript cDNA Synthesis kit (Bio-Rad) ...
-
bioRxiv - Genomics 2023Quote: ... DNA was extracted from these samples using a DNeasy kit (Qiagen), and prepared for sequencing using the TruSeq DNA PCR-Free platform ...
-
bioRxiv - Microbiology 2023Quote: ... The mgDNA was extracted with the DNeasy PowerSoil Pro kit (Qiagen) according to protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... was purchased from Santa Cruz Biotechnology. MinElute PCR Purification Kit (cat. 28004) was purchased from Qiagen. hCG and PMSG were purchased from Sansheng Biological Technology Co. ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA was extracted using the RNeasy Mini Kit (Qiagen, 74106) and RNase-Free DNase Set (Qiagen ...
-
bioRxiv - Immunology 2023Quote: ... and total RNA was isolated using the RNaesy Mini kit (Qiagen) according to the manufacturer’s instructions.
-
bioRxiv - Physiology 2023Quote: ... Total RNA was extracted using RNeasy Mini Kit (Qiagen, Hilden, Germany). mRNA was enriched by poly-A capture and mRNA-seq libraries were generated using KAPA Stranded mRNA-seq Kit (KAPA Biosystems ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by a column cleanup using the RNeasy Mini kit (Qiagen) with two additional washes (75% ethanol ...
-
bioRxiv - Microbiology 2023Quote: ... the sequence reactions were purified DyeEx Kits (Qiagen GmbH, Hilden, Germany) and were analyzed using the 3500 XL DNA Analyzer (Applied Biosystems ...
-
bioRxiv - Immunology 2023Quote: ... PCR products were purified using a PCR purification kit (Qiagen, 28006) and then cloned into the AbVec expression plasmids to produce recombinant human IgG1 mAbs (a gift from Patrick C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were prepared using the Qiagen HMR kit (Qiagen, Hilden, Germany). Paired-end sequencing was performed using the NextSeq 500 platform (Illumina ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was extracted from cells using RNeasy Kits (74004, QIAGEN) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... Donor plasmids were prepared with the HiSpeed Plasmid Maxi Kit (Qiagen). Eluted DNA was spot-dialyzed in a microinjection buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR product was purified using the QIAquick PCR purification kit (Qiagen) followed by A-tailing and ligation into a pGEM®-T Easy vector ...
-
bioRxiv - Genetics 2023Quote: ... DsRed negative neonate larvae with the Blood and Tissue kit (Qiagen) using PCR primers ACACTCTTTCCCTACACGACGCTCTTCCGATCTGCAGAAGCAGCTCGACGC and GACTGGAGTTCAGACGTGTGCTCTTCCGATCTGCAGCTGCCGGAAGTGCT (Illumina adapters underlined ...
-
bioRxiv - Cancer Biology 2024Quote: ... DNA was isolated using the QIAquick Gel Extraction Kit (Qiagen, 28704). DNA was sequenced by next-generation sequencing at the Biopolymers Facility at Harvard Medical School (NextSeq 500 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA was isolated using the RNeasy Micro Plus kit (QIAGEN). RNA libraries were generated from 150 ng of RNA using Illumina’s TruSeq Stranded mRNA Sample Prep Kit (Illumina) ...
-
bioRxiv - Developmental Biology 2024Quote: ... The reaction was immediately purified using Qiaquick PCR Purification Kit (Qiagen) and eluted in 20 μl water ...
-
bioRxiv - Developmental Biology 2024Quote: ... as per manufacturer’s instructions of the Micro RNEasy Kit (Qiagen, 74004), used for RNA extraction ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA purification was carried out using the RNeasy Mini Kit (Qiagen) with on-column DNase (Qiagen ...
-
bioRxiv - Neuroscience 2022Quote: ... and RNA was extracted using RNeasy Mini kits (Qiagen, ID: 217084) according to manufacture protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... and purified using the QiaQuick PCR Purification kit (Qiagen, Hilden, Germany). Purified DNA was then transcribed in vitro using the T7 mMessage Machine kit (Ambion ...