Labshake search
Citations for Qiagen :
9101 - 9150 of 10000+ citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: Genomic DNA was extracted using QIAamp Fast DNA Tissue Kit (Qiagen) according to manufacturer protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... and -Scramble cells using a RNeasy Mini Kit (Qiagen, Hilden, Germany) and underwent RT-qPCR to quantify Cd9 ...
-
bioRxiv - Neuroscience 2023Quote: bdEV RNA was extracted by miRNeasy Mini Kit reagents (Qiagen 217004) and Zymo-Spin I Columns (Zymo Research C1003-50 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Total RNA was extracted using the RNeasy kit (QIAGEN, Hilden, Germany), and poly(A ...
-
Borrelia PeptideAtlas: A proteome resource of common Borrelia burgdorferi isolates for Lyme researchbioRxiv - Biochemistry 2023Quote: ... Total RNA was extracted using Qiagen RNEasy Mini kits (Qiagen, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 1 colonies using a DNeasy Plant Mini Kit (QIAGEN, Hilden, Germany). We used DNeasy Blood & Tissue Kits (QIAGEN ...
-
bioRxiv - Genetics 2023Quote: ... RNA isolation was performed using RNeasy Micro Kit (Qiagen, cat# 7004), and reverse transcription was done using the iScript cDNA Synthesis Kit ...
-
bioRxiv - Genetics 2023Quote: ... genomic DNA was isolated from cells using Gentra Puregene Kit (Qiagen) and CRISPR-induced deletions were confirmed via PCR using primers adjacent to each end of the deletion ...
-
bioRxiv - Cancer Biology 2023Quote: RNA was extracted using the RNeasy mini kit (Qiagen, Hilden, Germany). Extracted RNA was quantified and its purity (absorbance at 260/280 nm ...
-
bioRxiv - Molecular Biology 2023Quote: ... and RNA extracted utilising the RNeasy Plus Mini Kit (Qiagen, 74136) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Tagmented DNA was purified using a MinElute PCR Purification Kit (Qiagen), then minimally amplified for sequencing as previously described97 ...
-
bioRxiv - Bioengineering 2023Quote: ... Total tissue DNA was extracted using the DNeasy Tissue Kit (Qiagen). The random oligonucleotide insertions from the enriched AAV library particles were amplified by PCR using the primers 5’–GGAGCTTCTTCTTGGGCTCT–3’ and 5’– AGCGGAGAAGGGTGAAAGTT–3’ ...
-
bioRxiv - Cancer Biology 2023Quote: ... and from blood by using either DNeasy Blood & Tissue Kit (Qiagen) or Maxwell® RSC Blood DNA Kit ...
-
bioRxiv - Microbiology 2023Quote: ... and the now discontinued DNeasy Powersoil DNA Isolation Kit (all Qiagen). For extractions with the DNeasy Powersoil Pro kit ...
-
bioRxiv - Developmental Biology 2023Quote: ... and PCR products purified using the QiaQuick PCR Purification kit (QIAGEN) following the published protocol (Johnson et al ...
-
bioRxiv - Genomics 2023Quote: ... reactions were pooled and purified using QIaquick PCR purification kit (QIAGEN). Then ...
-
bioRxiv - Genomics 2023Quote: ... and purified with the RNeasy Mini Kit (QIAGEN Cat. No. 74106). Libraries were constructed with the NEBNext Ultra Directional RNA Library Prep Kit for Illumina according to manufacturer’s recommendations (NEB ...
-
bioRxiv - Developmental Biology 2023Quote: ... Total RNA was extracted using the miRNeasy isolation kit (Qiagen 7004). Total RNA was retro-transcribed using SuperScriptTM VILOTM cDNA Synthesis Kit (ThermoFisher ...
-
bioRxiv - Microbiology 2023Quote: ... oral and vaginal specimens using the QIAamp DNA Mini Kit (QIAGEN) with some modification ...
-
bioRxiv - Developmental Biology 2023Quote: Total RNA was extracted from samples using RNeasy mini kit (Qiagen) and the resulting RNAs were reverse transcribed using SuperScript III Reverse Transcriptase (Life Technologies) ...
-
bioRxiv - Neuroscience 2023Quote: ... and purified with the Qiagen minielute PCR purification kit (Qiagen # 28004). Approx 10-20ng of TIC samples were then diluted in Illumina Tagmentation buffer and tagmented with the TDE1 enzyme as for ChIP samples ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA was isolated using the Qiagen RNeasy Mini Kit (QIAGEN GmbH) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: Genomic DNA was extracted using the DNeasy Blood & Tissue Kit (Qiagen) and CTNNB1 exon 3 was amplified using GoTaqβ G2 Flexi DNA Polymerase (Promega ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was isolated using the RNeasy Mini Kit (QIAGEN, #74106) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cell fractionation was performed with the Qproteome Cell Compartment kit (Qiagen).
-
bioRxiv - Neuroscience 2023Quote: ... First-strand cDNA was synthesized using QuantiTect Reverse Transcription Kit (QIAGEN). Real-time PCR was performed using SYBR® Premix Ex Taq™ II (Takara Bio ...
-
bioRxiv - Immunology 2023Quote: ... following manufacturer’s instructions using the RNeasy Plus Mini Kit (Qiagen, Germany). RNA sequence data was aligned to GRCm39/Ensembl v104 with transcript quantification by RSEM ...
-
bioRxiv - Genomics 2023Quote: ... DNA was isolated using a QIAquick PCR purification kit (Qiagen 28104). Input DNA was quantified using NanoDrop spectrophotometer or Qubit Fluorometer (ThermoFisher).
-
bioRxiv - Genomics 2023Quote: ... DNA extraction was performed using QIAamp DNA Mini Kit (Qiagen, Germany) according to manufacturer instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Plasmids were isolated with the Qiaprep Spin Miniprep kit (Qiagen, Germany). Primers were synthesized and purchased from IDT (USA) ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR products were purified with the QIAquick PCR Purification Kit (QIAGEN) following the manufacturer’s instructions ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: Total RNA was extracted using the RNAeasy Mini Kit protocol (Qiagen). Homogenization with sterile silicon beads was performed at maximum speed for 30 seconds in a Tissuelyzer (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted with the DNeasy Plant kit (QIAGEN, Hilden, Germany) with some modifications ...
-
bioRxiv - Molecular Biology 2023Quote: ... and digested backbone was gel-purified (Qiagen QIAquick Gel Extraction Kit). The backbone and insert were ligated with T4 DNA Ligase (NEB) ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from filters using the DNeasy PowerWater kit (QIAGEN) according to the manufacturer’s instructions supplemented by the optional addition of 1 μL ribonuclease A and 30 min incubation at 37 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... The digested insert was cleaned-up (Qiagen MinElute PCR Purification Kit), and digested backbone was gel-purified (Qiagen QIAquick Gel Extraction Kit) ...
-
bioRxiv - Neuroscience 2023Quote: ... and plasmid DNA purified with the Plasmid Plus Maxi Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... RNA extraction was performed using the miRNeasy® mini kit (QIAGEN) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA was isolated and processed using RNeasy Plus Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... DNA was purified using a MiniElute PCR Purification Kit (Qiagen; #28006) and eluted in nuclease-free water ...
-
bioRxiv - Cell Biology 2023Quote: ... Total RNA was isolated with RNeasy Micro or Mini Kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... and DNA was isolated using MinElute Reaction Cleanup Kit (Qiagen # 28206). Isolated CUT&RUN DNA fragments were quantified by Qubit and 5-10ng used for library preparation with the NEB Ultra II DNA Kit ...
-
bioRxiv - Biochemistry 2023Quote: ... and gel purified using the Qiagen NucleoSpin Gel cleanup kit (Qiagen). For transformation assays with DNA fragments ...
-
bioRxiv - Cancer Biology 2023Quote: ... and plasmid DNA was extracted using an EndoFree Maxi Kit (QIAGEN).
-
bioRxiv - Plant Biology 2023Quote: ... and subsequently purified using QIAquick PCR purification kit (28104, Qiagen, Germany) according to manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2023Quote: ... genomic DNA was isolated using the DNeasy Plant kit (Qiagen, Denmark) from two pooled ...
-
bioRxiv - Genetics 2023Quote: ... RNA was extracted using the RNeasy Plus Micro Kits (Qiagen #74034) and used to prepare RNA libraries utilizing the TruSeq Stranded mRNA Kit (Illumina #20020595 ...
-
bioRxiv - Immunology 2023Quote: ... RNA was isolated with the RNeasy Micro kit (Qiagen Cat # 74004). Paired-end library preparation and transcriptome sequencing was conducted by Novogene Co. ...
-
bioRxiv - Genetics 2023Quote: ... cDNA synthesis was done with QuantiTect Reverse Transcription Kit (Qiagen, #205313) and qRT-PCR reactions were run with HOT FIREPol SolisGreen qPCR Mix-reagent (Solis BioDyne ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... the tagged DNA was cleaned with the Min Elute kit (Qiagen) and processed to a sequencing library ...