Labshake search
Citations for Qiagen :
851 - 900 of 5865 citations for rno mir 32 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... RT-qPCR reactions were run using the QuantiTect SYBR Green RT-qPCR kit (Qiagen, 204243) on a Qiagen Rotor-Gene Q ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μL of 20 mM of each primer (KAN-2 FP1 or KAN-2 RP1 complementary to the Tn5 sequence with the bubble primer 224) and 10 μL of the 10X Qiagen Multiplex PCR Master Mix Kit (Qiagen, Valencia, CA, USA) in a final volume of 100 μL ...
-
bioRxiv - Plant Biology 2022Quote: ... All qPCR reactions were performed with primer concentrations at a final concentration of 250 nM in a Rotor-Gene Q real-time PCR cycler (Qiagen, Q-Rex v1.0), using the Rotor-Gene SYBR Green PCR Kit (Qiagen ...
-
bioRxiv - Genetics 2023Quote: ... 4 μL PCR mastermix (made up of 0.75 μl at a concentration of 0.2 μM of each primer, 80 μl ultrapure water, and 250 μl QIAGEN Multiplex PCR mix; QIAGEN Inc. Cat. No. 20614). PCR conditions were as follows ...
-
bioRxiv - Molecular Biology 2024Quote: ... Real-time quantitative PCR was performed on 40 pg cDNA using specific primers (Supplementary Table 1) and miRCURY® LNA® miRNA SYBR® Green PCR (Qiagen). Values were normalized to miRNA quantity and expressed as relative expression to control WS using formulae 2−ΔCT.
-
bioRxiv - Cancer Biology 2021Quote: ... using predesigned Quanititect Primer assays (Qiagen) to the following murine genes ...
-
bioRxiv - Molecular Biology 2021Quote: ... and QuantiTect primer assays (Qiagen, 249900) that were used for lncRNA and mRNA expression analysis are listed in Additional file 1 ...
-
bioRxiv - Cell Biology 2021Quote: ... The following miScript Primer Assays (Qiagen) were used ...
-
bioRxiv - Cell Biology 2021Quote: ... The following qPCR primers from Qiagen were used ...
-
bioRxiv - Systems Biology 2020Quote: ... Primers used were ordered from Qiagen, including GATA4 (QT00031997) ...
-
bioRxiv - Cancer Biology 2020Quote: ... The RT2 qPCR primer assays (Qiagen) or qPCR primers (IDT ...
-
bioRxiv - Cancer Biology 2019Quote: ... We purchased all primers from Qiagen, collected raw data and analyzed levels of relative mRNA expression with 2-ΔΔCt method ...
-
bioRxiv - Cancer Biology 2022Quote: ... The primers were: Hs_AREG (Qiagen; #QT00030772); Hs_PIDD1 (Qiagen ...
-
bioRxiv - Physiology 2021Quote: ... All primers were purchased from Qiagen.
-
bioRxiv - Immunology 2021Quote: ... and random hexamer primers (Qiagen, 79236) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... All primers were purchased from Qiagen.
-
bioRxiv - Cell Biology 2021Quote: ... All primers were purchased from Qiagen website ...
-
bioRxiv - Cell Biology 2020Quote: ... Predesigned QuantiTect® Primer Assays (Qiagen) were used for all genes ...
-
bioRxiv - Physiology 2022Quote: ... with validated gene-specific primers (Qiagen) on the QuantStudio™ 5 System ...
-
bioRxiv - Developmental Biology 2023Quote: ... ilp8 primers used from Qiagen (QT00510552), dmyc forward primer (AACGATATGGTGGACGATGG) ...
-
bioRxiv - Biochemistry 2023Quote: ... The U6 snRNA primer from Qiagen was used for normalization ...
-
bioRxiv - Cell Biology 2023Quote: ... with validated gene-specific primers (Qiagen) on the QuantStudio™ 5 System ...
-
bioRxiv - Molecular Biology 2023Quote: ... we purchased commercial primers from Qiagen. Primers for mouse Sprr1a (GeneCopoeia ...
-
bioRxiv - Immunology 2023Quote: ... Pre-synthesized QuantiTect primers from Qiagen were used for il12b ...
-
bioRxiv - Molecular Biology 2024Quote: ... Validated primers were obtained from Qiagen, UK for the miRNAs ...
-
bioRxiv - Neuroscience 2019Quote: ... qPCR was performed using a custom LNA probe for miR-1002 using the miRCury SYBR green reagent (Qiagen).
-
bioRxiv - Cancer Biology 2019Quote: ... cells were transfected with 12.5 or 6.25nM locked nucleic acid (LNA) miRNA inhibitors (miR-194 LNA inhibitor or negative control inhibitor; Qiagen).
-
bioRxiv - Developmental Biology 2022Quote: ... miR-1 miRCURY LNA miRNA Power Inhibitor and miRCURY LNA miRNA mimic were obtained from Qiagen (Germantown, MD). miR-1 inhibitor (Hsa-miR-1-3p ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted from a 10 mL culture using the QIAGEN® Genomic DNA Buffer Set and Genomic-tips™ 100/G set (midi-prep) (QIAGEN, Hilden, Germany). This procedure adhered to the Sample Preparation and Lysis Protocol for Bacteria as outlined in the QIAGEN® Genomic DNA Handbook ...
-
bioRxiv - Microbiology 2020Quote: ... 1 μL of the template was used in a 25 μL reaction using the QuantiFast Probe RT-PCR Kit (Qiagen, Inc., Valencia, CA) with 0.4 μM of each primer and 0.2 μM probe ...
-
bioRxiv - Microbiology 2022Quote: ... Total RNA (200 ng) was reverse-transcribed in cDNA and amplified by using QuantiNova SYBR Green RT-PCR kit (QIAGEN®, Hilden, Germany). Viral genomes were extracted from the supernatants at different time points post-infection using Takara MiniBEST Viral RNA/DNA (Takara Bio ...
-
bioRxiv - Plant Biology 2023Quote: ... RT-PCR reactions for each primer set were performed on RNA (50-75 ng/ul) from at least two biological replicates of the mutant allele and control (QIAGEN OneStep RT-PCR Kit, QIAGEN Inc., Cat # 210212). The bounds of where transcriptional termination and initiation occurs within Mu for each mutant allele was determined by presence of amplification from gDNA and absence of amplification from cDNA ...
-
bioRxiv - Cancer Biology 2024Quote: ... To profile the expression of genes related to p53-mediated signal transduction based on the RT² Profiler™ PCR Array Human p53 Signaling Pathway (#330231, PAHS-027ZC, Qiagen, Hilden, Germany), reverse transcription and qPCR were performed using the RT2 First Strand Kit (#330401 ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was treated with DNase (DNase-Free DNase Set, Qiagen) and repurified using the miRNeasy micro plus Kit (Qiagen) ...
-
bioRxiv - Cell Biology 2020Quote: ... Residual DNA was eliminated using RNAse-Free DNase Set (Qiagen). Sorted nuclei were pelleted before proceeding with downstream RNA isolation ...
-
bioRxiv - Developmental Biology 2021Quote: ... and DNAse-treated with the RNAse-free DNAse Set (QIAGEN). Samples were reverse transcribed using the TaqMan Reverse Transcription Kit (ThermoFisher) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and DNase-treated with the RNase-Free DNase Set (Qiagen). RNA was quantified using Qubit Fluorometric Quantitation (Life Technologies) ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA was treated with an RNase-free DNase set (Qiagen). The purified RNA was quantified spectrophotometrically (NanoDrop ND-1000).
-
bioRxiv - Molecular Biology 2021Quote: ... with on-column DNA digestion (RNase-free DNase Set, Qiagen) according to the manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2019Quote: 2.3.1 The Mini-Genomic DNA Buffer Set (Qiagen, Cat #: 19060) can be used to isolate the genomic DNAs from animal tissue samples.
-
bioRxiv - Neuroscience 2019Quote: ... and genomic DNA contamination quality control parameters set by Qiagen’s methods (RT2 Profiler PCR Array Data Analysis v3.5) ...
-
bioRxiv - Plant Biology 2020Quote: ... A DNase Digestion with the RNase-free DNase set (QIAGEN) was included in the procedure ...
-
bioRxiv - Cancer Biology 2021Quote: ... and concentration using the RNase-Free DNase Set (Qiagen 79254) and QIAquick PCR Purification Kit (Qiagen 28104) ...
-
bioRxiv - Cell Biology 2021Quote: ... set on HIGH and purified with Qiagen MinElute kit (Qiagen). After fragmentation ...
-
bioRxiv - Plant Biology 2020Quote: ... followed by DNAse treatment (RNase-free DNase set; Qiagen, Germany) and reverse transcription reaction (Omniscript RT kit ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA was treated with the RNase-free DNase Set (Qiagen) and quantified using the Qubit dsRNA High Sensitivity kit (Invitrogen) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and subsequently treated with RNase-Free DNase Set (QIAGEN #79254).
-
bioRxiv - Neuroscience 2020Quote: ... Total RNA was treated with RNase-Free DNase Set (Qiagen), following the kit’s instruction ...
-
bioRxiv - Plant Biology 2020Quote: ... DNA was removed using the RNase-Free DNase Set (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... RNA was treated with the RNase-Free DNase Set (Qiagen) with the manufacturer’s recommendations.