Labshake search
Citations for Qiagen :
851 - 900 of 10000+ citations for Mouse Protein Patched Homolog 2 PTCH2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA) (Qiagen, Hs_PLCB1_6, SI02781184); PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA ...
-
bioRxiv - Immunology 2021Quote: ... added 2 ul of RNase A (Qiagen), and 2 ul of Proteinase K (RNA grade ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA #2: 5’-AGCGACTGAGCCGCTATAATA-3’ (SI04232011, Qiagen); #3 ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 volumes of RNA protect (Qiagen) were added ...
-
bioRxiv - Microbiology 2020Quote: ... a monoclonal mouse Strep-tag antibodies (#34850, Qiagen), a monoclonal anti-actin antibody (A5441 ...
-
bioRxiv - Cell Biology 2023Quote: ... or siRNA for Anxa2 (Mouse, Qiagen, Mm_Anxa2_3, SI00167496).
-
bioRxiv - Biochemistry 2023Quote: Mouse EL4 genomic DNA was isolated by QIAGEN Blood & Cell Culture DNA Kit (QIAGEN ...
-
bioRxiv - Cancer Biology 2023Quote: ... Mouse tissues were homogenized using TissueLyser II (Qiagen) and stainless-steel beads (5 mm ...
-
bioRxiv - Microbiology 2019Quote: ... and the 6xHis-SUMO tagged proteins were purified from the soluble protein fraction after centrifugation using an Ni2+-NTA Superflow column (Qiagen, Venlo, Netherlands). Next ...
-
bioRxiv - Cancer Biology 2021Quote: The recombinant hexahistidine-tagged TNC-C and EDB WT and mutant proteins (at 60 μg of protein / 40 μl beads in PBS) were immobilized to Ni-NTA Magnetic Agarose Beads (QIAGEN, Hilden, Germany) at RT for 1 h ...
-
bioRxiv - Microbiology 2024Quote: ... Approximately 2-4 ml of cells were harvested at each timepoint and incubated with 2 volumes of RNAprotect (Qiagen) at room temperature for 5 minutes prior to centrifugation for 5 minutes at 4000xg 4°C ...
-
bioRxiv - Cancer Biology 2019Quote: ... His-tagged proteins were purified on NiNTA beads (Qiagen). Purified proteins were eluted with 500 mM NaCl ...
-
bioRxiv - Cell Biology 2020Quote: ... Proteins were purified with Ni-NTA affinity resin (Qiagen). The aminoacylation assay protocol from Jiongming Lu was then followed (Lu et al. ...
-
bioRxiv - Biochemistry 2020Quote: ... Protein were purified using Ni-NTA agrose (Qiagen, 30210) according to the manufacturer’s manual ...
-
bioRxiv - Biochemistry 2021Quote: ... Soluble protein was mixed with Ni-NTA resin (Qiagen) for 1h at 4 degrees on a nutator ...
-
bioRxiv - Biochemistry 2020Quote: ... Fusion proteins were purified through consecutive Ni-NTA (Qiagen), amylose (NEB) ...
-
bioRxiv - Biophysics 2021Quote: ... purified N protein was incubated with RNAse A (Qiagen) with 1:15 (RNAse A ...
-
bioRxiv - Biophysics 2020Quote: ... Proteins were either purified using NI-NTA agarose (Qiagen) or anti C-tag beads ...
-
bioRxiv - Plant Biology 2021Quote: ... labeled proteins were incubated with Ni-NTA agarose (Qiagen) on a rotary shaker for 1 h at RT ...
-
bioRxiv - Plant Biology 2021Quote: ... recombinant protein and purified using Ni-NTA resin (Qiagen). Polyclonal antibodies were raised in mice as described in 1 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Recombinant protein was purified using Ni-NTA agarose (Qiagen). Rabbit polyclonal antibodies were generated by Covance ...
-
bioRxiv - Biochemistry 2021Quote: ... the protein was purified by Ni-NTA agarose (Qiagen) and eluted with lysis buffer containing 300 mM imidazole ...
-
bioRxiv - Microbiology 2020Quote: Protein was purified using Ni-NTA agarose column (Qiagen). A detailed protocol is described in supplementary materials and methods.
-
bioRxiv - Neuroscience 2020Quote: ... GAPDH protein was purified by Ni-NTA chromatography (Qiagen) under native conditions ...
-
bioRxiv - Biophysics 2021Quote: ... Proteins were purified using Ni-NTA resin (Qiagen, Germany) on a gravity flow column followed by size-exclusion chromatography on a Superdex® 200 Increase 10/300 GL column (GE Healthcare Life Sciences ...
-
bioRxiv - Biophysics 2020Quote: ... Protein purification was performed using Ni-NTA resin (Qiagen) equilibrated with the lysis buffer containing 20 mM imidazole ...
-
bioRxiv - Biophysics 2022Quote: ... Proteins were purified by Nibaffinity (Ni-NTA agarose, Qiagen) then passed over an anion-exchange column (Hitrap Q HP ...
-
bioRxiv - Genomics 2019Quote: ... We added 200 µl of Protein Precipitation Solution (Qiagen) and centrifuged at 15,000 rpm for 3 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... Genes for protein purification were cloned into pQE30 (QIAGEN). Raw 264.7 and U937 cells were cultured in RPIM1640 medium in the presence of 10% FBS ...
-
bioRxiv - Genomics 2020Quote: ... total proteins and RNA were extracted (RNeasy Qiagen 74104) according to the manufacturer’s instructions and analyzed.
-
bioRxiv - Microbiology 2023Quote: ... The proteins were purified with Ni-column chromatography (Qiagen) by following the manufacturer’s recommendations.
-
bioRxiv - Biochemistry 2023Quote: ... Fusion proteins were purified through consecutive Ni-NTA (Qiagen), amylose (NEB) ...
-
bioRxiv - Biochemistry 2023Quote: ... Protein was purified through Ni-NTA agarose beads (Qiagen) (Lysis Buffer ...
-
bioRxiv - Biochemistry 2022Quote: ... Expressed proteins were captured on Ni-NTA Superflow (Qiagen) equilibrated with Buffer A containing 5 mM imidazole ...
-
bioRxiv - Biochemistry 2023Quote: ... protein was captured using Ni-NTA affinity chromatography (Qiagen). Protein was further purified using ion exchange chromatography preceding size exclusion chromatography on a HiLoad 16/600 Superdex 75 prep grade column (GE Healthcare ...
-
bioRxiv - Cell Biology 2023Quote: ... The protein was purified with Ni-NTA Agarose (Qiagen), dialyzed to PBS containing 6 M urea ...
-
bioRxiv - Biochemistry 2024Quote: ... protein purification was performed using Co+NTA agarose (Qiagen), followed by a Phenyl Sepharose column ...
-
bioRxiv - Cell Biology 2020Quote: One colony per clone corresponding to ∼2×104 cells and 2×103 primary cells of each individual were lysed in RLT Plus (Qiagen) and stored at −80°C until processing ...
-
The gut hormone Allatostatin C regulates food intake and metabolic homeostasis under nutrient stressbioRxiv - Physiology 2020Quote: ... were homogenized in 2-mL tubes containing lysis buffer plus 1% 2-mercaptoethanol using a TissueLyser LT bead mill (Qiagen) and 5-mm stainless-steel beads (Qiagen #69989 ...
-
bioRxiv - Microbiology 2021Quote: Swab RNA was extracted from 0.2 ml of swab solutions (1ml of DMEM with 2% fetal bovine serum [Cytiva]) using QIAamp Viral RNA Minikit (QIAGEN) and subjected to real-time RT-PCR for viral RNA quantitation [40] using QuantiTect Probe RT-PCR Kit (Qiagen ...
-
bioRxiv - Genetics 2021Quote: ... ThermoScientific catalog numbers A32955 and 78420)) using a bead mill with steel beads (2 x 2 min at 20 Hz; TissueLyser, Qiagen). Extracts were cleared by centrifugation (17,000 RCF ...
-
bioRxiv - Microbiology 2022Quote: ... and 150 μL DMEM supplemented with 2% FBS and homogenized using a TissueLyser II (2 cycles at 30 Hz, 1 min, Qiagen). Homogenates were clarified by centrifugation and frozen until plaque assay titration ...
-
bioRxiv - Physiology 2023Quote: ... the RNAs from livers (n = 2 mice/group, each group contains RNAs pooled from 2 mice) were prepared (RNeasy, Qiagen). Ribosomal RNA was removed with the Ribozero HMR Gold kit (Illumina).
-
bioRxiv - Genomics 2020Quote: ... cells were mixed 1:2 with RNAProtect (Qiagen) and harvested via centrifugation ...
-
bioRxiv - Genomics 2021Quote: ... Samples were treated with 2 µg RNaseA (Qiagen) and DNA was purified using the QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Genomics 2019Quote: ... 2) purifying twice using gDNA-eliminator columns (QIAGEN) before and after DNase treatment followed by RNeasy column purification (QIAGEN) ...
-
bioRxiv - Cell Biology 2020Quote: ... and Mm Aldoa 2 FlexiTube siRNA (Qiagen, SI00896238) according to the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2022Quote: 2 mL of Ni-NTA resins (Qiagen, USA) were packed into a 5 mL column ...
-
bioRxiv - Cell Biology 2022Quote: ... oligo #2 (Q2) 5’-CCCGAAATATTTAGGCCTGAA-3’ (Qiagen, SI00758415) and oligo 5 (Q4 ...
-
bioRxiv - Molecular Biology 2023Quote: ... with Negative Control GapmeR A (30300019-2, Qiagen) using 3.5 μl of Lipofectamine 2000 in Opti-MEM I reduced serum medium following the manufacturer’s suggested protocol ...